ID: 1039610768

View in Genome Browser
Species Human (GRCh38)
Location 8:38917625-38917647
Sequence AAGCCCAGACTTTAGATCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039610768_1039610773 16 Left 1039610768 8:38917625-38917647 CCCCTGATCTAAAGTCTGGGCTT 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1039610773 8:38917664-38917686 TAAAGTGCCCAATGCTATCCTGG No data
1039610768_1039610771 -10 Left 1039610768 8:38917625-38917647 CCCCTGATCTAAAGTCTGGGCTT 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1039610771 8:38917638-38917660 GTCTGGGCTTATCTCCTCTATGG No data
1039610768_1039610774 17 Left 1039610768 8:38917625-38917647 CCCCTGATCTAAAGTCTGGGCTT 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1039610774 8:38917665-38917687 AAAGTGCCCAATGCTATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039610768 Original CRISPR AAGCCCAGACTTTAGATCAG GGG (reversed) Intronic
903972456 1:27127870-27127892 AAGCCCAGGCTGGGGATCAGGGG + Intronic
904249235 1:29210944-29210966 ATTCCCAGACTTTAGCTCTGAGG + Intronic
907211743 1:52829574-52829596 TAGCCCAGACTGGAGAGCAGTGG - Intergenic
907248471 1:53122642-53122664 TGGCCCAGACTTTAGCTGAGTGG - Intronic
910844909 1:91595441-91595463 AAGCCCAGAACTTAGAGAAGGGG - Intergenic
912010185 1:104949665-104949687 AAGCTCAGTGTTTAAATCAGAGG + Intergenic
914334220 1:146700387-146700409 AAGCCCAGACCTTGGCTTAGAGG + Intergenic
914861000 1:151386075-151386097 ACGCCCAGCCTATAGAACAGGGG + Intergenic
915257123 1:154642103-154642125 AAGTCCATAGTTTACATCAGGGG + Intergenic
917598275 1:176551740-176551762 CAGCCCAATCTTTAGATAAGAGG + Intronic
919753731 1:201053824-201053846 AAGCCCACACTTGGGAGCAGTGG + Intronic
920989734 1:210925545-210925567 GAGACCAGACTTTAGGACAGAGG + Intronic
922343708 1:224678365-224678387 AAGCATAGACTATAGAACAGAGG + Intronic
922921522 1:229309136-229309158 ATGGCTAGGCTTTAGATCAGAGG - Intergenic
924062857 1:240194378-240194400 AAGGACAGATTTTATATCAGTGG + Intronic
1063179786 10:3587838-3587860 TAGCCAAGATTTTACATCAGAGG - Intergenic
1063910865 10:10828997-10829019 AAGACCAGAGTTTAGAAGAGGGG + Intergenic
1064477970 10:15711871-15711893 AAGGCCAGAGTTTAGGTCTGTGG - Intronic
1064844986 10:19641889-19641911 AAGGACAGAGTTTAGATCTGTGG - Intronic
1069015654 10:63426315-63426337 TAGCCCAGACTTAAGTGCAGTGG - Intronic
1070977828 10:80619516-80619538 AAGCCCAGCATTTAGATTGGGGG - Intronic
1072106272 10:92277486-92277508 AAGAATAGAATTTAGATCAGTGG - Intronic
1080876200 11:36276634-36276656 AAGCTCAGAGGTTAGATAAGTGG - Intronic
1082747378 11:56979688-56979710 GAGCCCAGGCTTGAGTTCAGTGG - Intergenic
1083694484 11:64433579-64433601 AAGCCCAGGCTTGAGTGCAGTGG + Intergenic
1083814556 11:65125353-65125375 ACCTCCAGACTTTAGGTCAGGGG - Intronic
1083941511 11:65898919-65898941 TTGCCCAGACTATAGAGCAGTGG - Intronic
1086676176 11:89609785-89609807 AAGCCAAGACTTTTGATCTATGG - Intergenic
1090943829 11:131411971-131411993 AATCCCAGGCTTGAGAACAGAGG - Intronic
1092352418 12:7766431-7766453 AAGCCCAGACTGGAGTGCAGTGG - Intronic
1095251604 12:39985722-39985744 AATGCCAGACTTGAGATCACAGG + Intronic
1095474971 12:42577341-42577363 TAAACCAGACTTTTGATCAGGGG + Intronic
1096213390 12:49784116-49784138 AAGTCCAGAGTTTAGAAAAGAGG - Intergenic
1096685834 12:53287809-53287831 CAGCCAACACTCTAGATCAGGGG - Intronic
1098312413 12:69160812-69160834 AAGCCCTGAGTTTAGGGCAGAGG - Intergenic
1098475385 12:70895753-70895775 AATTCCAGACATTAGGTCAGTGG - Intronic
1099816032 12:87648768-87648790 CAGCCCAGACTCAAGAACAGAGG + Intergenic
1101052741 12:100880457-100880479 AAGTCCAGACTTTAACTCAGAGG + Intronic
1101397442 12:104360774-104360796 AAGTCCAGAGTTTACATTAGGGG - Intergenic
1102407849 12:112689514-112689536 AAGCCCAAACTCCAAATCAGAGG - Intronic
1103937739 12:124485500-124485522 ACGCCCTGACTTCAGATCACGGG + Intronic
1104285647 12:127422152-127422174 AAACTCAGAGTTTAGCTCAGAGG - Intergenic
1108086617 13:46799753-46799775 AGGACCAGACTTTGGATCATGGG + Intergenic
1108601506 13:51999075-51999097 CAGCCCAGCCTTCAGAACAGAGG + Intronic
1110004287 13:70247005-70247027 ACGCCCAGACTAAAGTTCAGTGG + Intergenic
1110702131 13:78561263-78561285 AAGTCCAGCCTTTTGAACAGAGG - Intergenic
1112345635 13:98586794-98586816 ATAGCCAGCCTTTAGATCAGGGG + Intergenic
1116241493 14:42348811-42348833 AAGCCATGATGTTAGATCAGTGG + Intergenic
1120414096 14:84196998-84197020 TAGCCCAGACTTGAGTGCAGTGG - Intergenic
1120455049 14:84719382-84719404 ATGCGGAGACTTTAGTTCAGGGG + Intergenic
1120900450 14:89570795-89570817 AAGACCTGGGTTTAGATCAGGGG - Intronic
1121420297 14:93808335-93808357 AAGCCCAGAATTTACATCCAAGG + Intergenic
1121984219 14:98485928-98485950 AAGCACAGACTGTATAGCAGAGG + Intergenic
1127973200 15:63978407-63978429 AACCCCAGACTTCATGTCAGTGG - Intronic
1129894683 15:79094566-79094588 TGGCCCAGGCTTTAGACCAGTGG - Intergenic
1130253408 15:82314965-82314987 AAGCCCAGATTTCAGAGGAGGGG - Intergenic
1130696476 15:86136616-86136638 GAGCCCAGACTTGAGAGCAGAGG + Intergenic
1131335997 15:91549580-91549602 AAGTTCATAATTTAGATCAGAGG + Intergenic
1132112585 15:99113210-99113232 AAGCCAAGACTAGAAATCAGGGG - Intronic
1132931088 16:2459599-2459621 AAGCTCAGACCTTGGAGCAGTGG - Intergenic
1133551434 16:6858782-6858804 AAACCCAGAAATTAGAGCAGTGG + Intronic
1134804696 16:17114328-17114350 AGGCCCAGACTTGTGATTAGCGG + Intronic
1135941993 16:26829810-26829832 AACCACAGACATTAGCTCAGAGG + Intergenic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1138051186 16:53780310-53780332 AGGCCCAGACTAAAGATCTGGGG - Intronic
1138470043 16:57227243-57227265 AATCCCAGCCATTAGGTCAGTGG + Intronic
1139999398 16:71010845-71010867 AAGCCCAGACCTTGGCTTAGAGG - Intronic
1140115658 16:72039233-72039255 AATGCCAGACTTGAGATTAGGGG - Intergenic
1141107415 16:81244928-81244950 TTGCCCAGACTTTAGTGCAGTGG + Intronic
1143122757 17:4619192-4619214 TAGCCCAGACTGGAGAGCAGTGG + Intergenic
1143403761 17:6662608-6662630 AAACTCAGACTTTTGATAAGGGG - Intergenic
1146083920 17:29809593-29809615 AAGCCCAGACTGCAGGGCAGTGG + Intronic
1148285585 17:46388136-46388158 AATCTCAGACTTTACATCAGTGG - Intergenic
1148307748 17:46605737-46605759 AATCTCAGACTTTACATCAGTGG - Intronic
1148370381 17:47095296-47095318 TAGCCCAGACTGTAGTGCAGTGG - Intergenic
1155985573 18:32227284-32227306 AAGCCCAGGCTGTAGTGCAGTGG - Intronic
1156727767 18:40149573-40149595 AAGACCATACTTTTGATCTGAGG - Intergenic
1157929763 18:51808752-51808774 ATGCCCAGAGTTAAGATTAGGGG - Intergenic
1161743596 19:6041106-6041128 TAGCCCAGACTTGAGTGCAGTGG + Intronic
1163529814 19:17842677-17842699 AAACCCAGGCTTTAGCCCAGGGG + Intronic
1163651981 19:18523045-18523067 CAGCCCAGACTGGAGAACAGTGG + Intergenic
1163969596 19:20779378-20779400 AAAGTCAGATTTTAGATCAGAGG + Intronic
1168638151 19:58012454-58012476 AAGCCCAGAGCTCAAATCAGGGG + Intergenic
926727151 2:16007546-16007568 GAGCCCAGAATTTAGGTCAGAGG + Intergenic
931500777 2:62863884-62863906 TTGCCCAGACTATAGTTCAGTGG + Intronic
933457701 2:82537812-82537834 AAGCCCATTCTATAGACCAGTGG + Intergenic
933501294 2:83114893-83114915 AAGCCCAGATTTTAGTACAGTGG + Intergenic
935642560 2:105305051-105305073 AAGCCCATAGTTTATATTAGGGG - Intronic
935768831 2:106397295-106397317 AAGCCCAGACTGGAGTGCAGTGG + Intronic
942955695 2:181770537-181770559 TAGCCCAATCTTTTGATCAGGGG + Intergenic
944024536 2:195147383-195147405 AAGCCCAGAGGTTACATGAGAGG - Intergenic
944786738 2:203078724-203078746 AACCACACAGTTTAGATCAGAGG + Intronic
944887136 2:204074656-204074678 AAGCCCAGTCTATGAATCAGAGG - Intergenic
946341508 2:219072271-219072293 AAGCCCATACTTTATAGGAGGGG - Intergenic
946716321 2:222557697-222557719 AATCCCATTCTTTAGAACAGTGG - Intronic
1168977972 20:1982215-1982237 TAGCCCAGACTTGAGTGCAGTGG - Intronic
1172684091 20:36740021-36740043 AACCCCAGACTGTAGACCATGGG + Intronic
1173955680 20:47030795-47030817 TAGCCCAGACTGTAGTGCAGTGG + Intronic
1179138771 21:38703653-38703675 TAGCCCAGACTGGAGAGCAGTGG - Intergenic
1182989548 22:34754041-34754063 AACCCCAGGCTTTAGGGCAGGGG - Intergenic
949963637 3:9336254-9336276 TAACCCAGACTATAGTTCAGTGG + Intronic
951403489 3:22264388-22264410 AAGCCAAGACAATTGATCAGTGG + Intronic
953655286 3:44846868-44846890 AAGGGCAGACTATAGCTCAGGGG + Intronic
956042129 3:65155688-65155710 GAGCCCAGAATTGAGCTCAGGGG - Intergenic
956414050 3:69008746-69008768 AAGCCCAGACTTTCGGTTAGGGG - Intronic
956677419 3:71749211-71749233 GAGCCCAGACTTTGGCTCATTGG - Intronic
957236091 3:77593743-77593765 TAGCCCAAACTTGAGAACAGAGG + Intronic
957238622 3:77627860-77627882 AAGCACAGACTTTAGCTTAATGG + Intronic
957769881 3:84676817-84676839 AAGCCATGATTTTAGAACAGTGG - Intergenic
960221542 3:115116410-115116432 AAGCCCATACTGTAGAATAGTGG - Intronic
960311521 3:116121999-116122021 CAGCACAGACTCTAGAACAGGGG - Intronic
963069886 3:141295080-141295102 AAGCACAGAGATGAGATCAGTGG + Intergenic
963098292 3:141570259-141570281 AAGCCCAGACTGGAGTACAGTGG + Intronic
963299248 3:143580683-143580705 AAGTGCAGACTACAGATCAGTGG - Intronic
963464009 3:145654560-145654582 AAGCCCATAGTTTACATTAGGGG - Intergenic
965994101 3:174857739-174857761 CAACCCAGATTTTAAATCAGAGG + Intronic
966509041 3:180740626-180740648 AAGCCCATAATTTAAATCACTGG - Intronic
970913484 4:21306414-21306436 TAGCCCAGGCTTGAGAGCAGTGG + Intronic
974606606 4:64159949-64159971 TTGCCCAGACTGGAGATCAGTGG - Intergenic
974895052 4:67928082-67928104 AAGCCCAGGCTTGAGTGCAGTGG + Intronic
977050878 4:92127892-92127914 AAGACCAGAATGTAGACCAGTGG + Intergenic
978317681 4:107457762-107457784 ATGTACATACTTTAGATCAGCGG - Intergenic
979427808 4:120589473-120589495 AAGTACAGATTTTAGATCAGAGG - Intergenic
980311904 4:131141908-131141930 AAGCCCAGGATGGAGATCAGTGG - Intergenic
980902113 4:138914903-138914925 GAGCCCAGTGTTTTGATCAGGGG - Intergenic
981005484 4:139870607-139870629 AAGGTCAGAATTTAGAACAGAGG - Intronic
982828625 4:160031189-160031211 CTGCCCAGACTTTAGTGCAGTGG - Intergenic
987511112 5:18840443-18840465 AAGCCCTGACTTTTGATCACAGG + Intergenic
990522836 5:56595995-56596017 AACCCCAGACTGTAGGTCTGTGG - Intronic
990535471 5:56717372-56717394 AAACCCAGCCTTTACATAAGAGG + Intergenic
994079429 5:95690338-95690360 AAGCCCAGAATTTAGATACCAGG - Intronic
995273081 5:110245183-110245205 AAACCAAGACTTTAAAACAGTGG - Intergenic
997721473 5:136081120-136081142 AAGCCCAGAATTGAGATCACAGG + Intergenic
999116018 5:149163827-149163849 AAGCACAGACTTGAAATTAGGGG - Intronic
999417411 5:151410983-151411005 AAGTATAGACTTTAGACCAGTGG - Intergenic
1001094125 5:168762922-168762944 AAGACCAGACTCAAGATCTGTGG + Intronic
1001591506 5:172868677-172868699 AAGTCCATACTTGACATCAGGGG - Intronic
1002362812 5:178686580-178686602 GAGCCCAGACTGTAGTGCAGTGG - Intergenic
1004557256 6:16711087-16711109 AAGTACAGACTGCAGATCAGTGG + Intronic
1005382845 6:25254862-25254884 AATCCCAGAAGTTGGATCAGAGG - Intergenic
1005882253 6:30070674-30070696 TAGCCCAGTCCTTAGATCTGTGG + Exonic
1006681942 6:35803612-35803634 AAGCCCAGACTGGAGTGCAGTGG + Intergenic
1008042315 6:46815412-46815434 AAGCCCAGCCTTTAGGACTGCGG - Intronic
1008042500 6:46816752-46816774 AAGCCCAGCCTTTAGGACTGCGG + Intronic
1008717087 6:54301834-54301856 AAGACCAGACTTCAGACAAGAGG + Intergenic
1008938614 6:57020458-57020480 TAGCCCAGGCTGTAGTTCAGTGG + Intronic
1009055490 6:58329673-58329695 AAGGCCAGACTTCATATCAGAGG - Intergenic
1010527985 6:76926502-76926524 AAGCCTAGACATTAGTTTAGGGG - Intergenic
1013130029 6:107223828-107223850 AATCCCAGAGTCTAGAGCAGGGG + Intronic
1014413828 6:121158922-121158944 AAGCCCAGCCATAAGACCAGTGG - Intronic
1017055198 6:150430208-150430230 AAGCCCAGACCTGAGTTCACTGG - Intergenic
1017170190 6:151449327-151449349 TCGCCCAGACTTTAGTGCAGTGG - Intronic
1022152667 7:27624735-27624757 AAGACCATACTGTTGATCAGGGG - Intronic
1022171003 7:27831125-27831147 AAGACCATACTTCAGATCTGAGG + Exonic
1023416209 7:39935355-39935377 AAGCCCATAGTTTACATTAGGGG + Intergenic
1025961746 7:66229055-66229077 AAGACAAAACTATAGATCAGTGG - Intronic
1026096519 7:67350896-67350918 AACCCCAGAAATCAGATCAGTGG + Intergenic
1027595248 7:80165003-80165025 AAGCTCAGACTTTATATGTGAGG + Intronic
1029284404 7:99455984-99456006 AACCCCAGACCTTGGCTCAGAGG + Intronic
1034073810 7:148213217-148213239 AGTCCCAGAATTTAGCTCAGGGG - Intronic
1034419780 7:150983628-150983650 AATCCCAGTCTTTAAATCAAAGG - Intergenic
1038585177 8:28781907-28781929 AAGCCCAGAGTTTACAGTAGGGG - Intronic
1039610768 8:38917625-38917647 AAGCCCAGACTTTAGATCAGGGG - Intronic
1040334110 8:46407442-46407464 AAACCCAGACTTTGAAGCAGGGG + Intergenic
1043007138 8:74833824-74833846 AAGCCCATGCTTTAAATCAGGGG + Intronic
1044109800 8:88258315-88258337 GAGCCTATACTTAAGATCAGTGG + Intronic
1051530900 9:18101839-18101861 ATGTCTTGACTTTAGATCAGAGG + Intergenic
1052060103 9:23949523-23949545 AAGCCTTGACTCTAGATCAGGGG + Intergenic
1052668414 9:31523659-31523681 AAGCACAGGCTTGGGATCAGGGG + Intergenic
1054710943 9:68510113-68510135 AAGCCCAACCTTTGTATCAGAGG - Intronic
1057339561 9:94187822-94187844 AAGCCCAGACTTAATATAAAAGG - Intergenic
1059083589 9:111275853-111275875 AAGCCCAGACTGGAGTGCAGTGG + Intergenic
1059635031 9:116162018-116162040 CAGCCCAGGCTTCAGATCTGAGG + Intronic
1059734431 9:117087272-117087294 ATGCCCAGTCTTTAGTGCAGAGG + Intronic
1059862048 9:118475770-118475792 AAGGCCAGACTTGACCTCAGGGG - Intergenic
1187006933 X:15241420-15241442 GAGCCCAGTCTGTAGGTCAGAGG - Intronic
1189986612 X:46558892-46558914 AAGCCCAGACTGGAGTGCAGTGG - Intergenic
1190980477 X:55452929-55452951 AAGGCCAGTCTTTAGAGCATCGG - Exonic
1192855299 X:75003872-75003894 AAGTACAGAGTCTAGATCAGAGG - Intergenic
1200809160 Y:7464253-7464275 AAACCCTGACTTCAGCTCAGTGG + Intergenic