ID: 1039615391

View in Genome Browser
Species Human (GRCh38)
Location 8:38951216-38951238
Sequence TGTTCGGCACAGAACTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039615391_1039615398 21 Left 1039615391 8:38951216-38951238 CCTGTGCAGTTCTGTGCCGAACA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1039615398 8:38951260-38951282 GTTTGTGAAACCATAGGAAATGG No data
1039615391_1039615399 22 Left 1039615391 8:38951216-38951238 CCTGTGCAGTTCTGTGCCGAACA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1039615399 8:38951261-38951283 TTTGTGAAACCATAGGAAATGGG No data
1039615391_1039615395 -2 Left 1039615391 8:38951216-38951238 CCTGTGCAGTTCTGTGCCGAACA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1039615395 8:38951237-38951259 CACGGGAGACACAGAAGATGAGG No data
1039615391_1039615396 -1 Left 1039615391 8:38951216-38951238 CCTGTGCAGTTCTGTGCCGAACA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1039615396 8:38951238-38951260 ACGGGAGACACAGAAGATGAGGG No data
1039615391_1039615397 15 Left 1039615391 8:38951216-38951238 CCTGTGCAGTTCTGTGCCGAACA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1039615397 8:38951254-38951276 ATGAGGGTTTGTGAAACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039615391 Original CRISPR TGTTCGGCACAGAACTGCAC AGG (reversed) Intronic
902756648 1:18553326-18553348 TCTATGGCTCAGAACTGCACAGG + Intergenic
904648605 1:31987411-31987433 TCTTCTGCCCAGAACTCCACAGG + Intergenic
904812625 1:33173196-33173218 TGTGTGGCTCAGAAGTGCACAGG - Intronic
906230726 1:44161299-44161321 GGATGGGCACAGAACTGCATAGG - Intergenic
911703454 1:100982959-100982981 TGTTTGGTACAATACTGCACCGG + Intergenic
917957419 1:180114716-180114738 TGTTCGGTGCAAAATTGCACTGG - Exonic
918256438 1:182752869-182752891 TGATCTGCAGAGCACTGCACAGG + Intergenic
919432695 1:197516596-197516618 TGTTCGGAACATAACAACACAGG + Intronic
919502990 1:198361602-198361624 AGTTCAGCAGAGAAGTGCACAGG - Intergenic
921585375 1:216940439-216940461 AGTTCGGCACAGAATTTCCCCGG - Intronic
1065022644 10:21513305-21513327 TGTTCTGCACAGAACCTGACTGG + Intergenic
1065412953 10:25450311-25450333 TCTTCAGCACAGAACAGCCCCGG - Intronic
1069820151 10:71222585-71222607 TGTTCTGCCCAGAGATGCACAGG - Intronic
1069958789 10:72067720-72067742 TGTTCTGCAGAGACTTGCACCGG - Exonic
1072935783 10:99711877-99711899 TGTTCTGCATAGAACTGTATAGG + Intronic
1075465630 10:122648359-122648381 AAGTCAGCACAGAACTGCACAGG + Intergenic
1089801219 11:121029904-121029926 TGCTCTGCACAAAACTGAACTGG + Intronic
1091802490 12:3333558-3333580 TGCTGGGCTCAGAACTGCATTGG + Intergenic
1100595770 12:96070776-96070798 TGTGCAGCACAGAACAGCAACGG - Intergenic
1103606709 12:122092015-122092037 TGTTTGCCACAGAACGGCTCTGG + Intronic
1104410322 12:128552141-128552163 TGTTCAGCACCTAACAGCACAGG - Intronic
1116183988 14:41572805-41572827 TTTTCAACACAGAAATGCACTGG + Intergenic
1119390008 14:74284846-74284868 TGTTAAGAACAGAACAGCACTGG + Intergenic
1122979735 14:105186045-105186067 TGTGGGGCACAGAAGTCCACTGG + Intergenic
1125479128 15:40068633-40068655 TGTTGGACACAGAATTGCTCTGG + Intergenic
1131222727 15:90598510-90598532 TTTCCTGCACAGAACTGCAGAGG + Intronic
1131690286 15:94820091-94820113 TGTTGGGCACAGAACTGGTAGGG - Intergenic
1133099280 16:3469509-3469531 TGCTCCGCACAGCACTGCCCTGG + Intronic
1133280681 16:4663563-4663585 TGTCTGGCACAGAACAGCAATGG - Intronic
1144071819 17:11680881-11680903 TGTTCGGCCCATACCTGAACGGG - Exonic
1145058578 17:19718485-19718507 TGTTCAGCACTCAGCTGCACAGG + Intronic
1153117456 18:1676811-1676833 TGTACGGCAATCAACTGCACAGG + Intergenic
1160974960 19:1788685-1788707 TGTTGGGCACAGAGCTAGACAGG + Intronic
1164483807 19:28637649-28637671 TTTTCACTACAGAACTGCACTGG - Intergenic
1167567197 19:50264153-50264175 TGTTGTCCACAGAACTTCACTGG - Intronic
1168582458 19:57566864-57566886 TGTTCTGCATTGAACTACACTGG - Intergenic
942957114 2:181786569-181786591 TTTTTGACACAGAAGTGCACTGG + Intergenic
946431366 2:219628660-219628682 TGTCCGGCACAGGATGGCACTGG - Intronic
1171296576 20:24022141-24022163 TGTGCAGCATAAAACTGCACAGG - Intergenic
1174097041 20:48097733-48097755 TGTCTGGCTCAGAAATGCACTGG - Intergenic
1179587184 21:42380836-42380858 TGTTCTGCACAGAAAAGCTCGGG - Intronic
1184583508 22:45432511-45432533 TGTTCCTCACAGAAATACACGGG - Intergenic
1184815526 22:46866010-46866032 ATTTCGGCACAGAACTTCAACGG - Intronic
953054021 3:39372991-39373013 GGTTCTGCACAGACATGCACTGG - Intergenic
954045688 3:47927897-47927919 TGCCTGGCACAGAACAGCACTGG + Intronic
959157142 3:102680391-102680413 GGTGAGGAACAGAACTGCACAGG - Intergenic
960143285 3:114171928-114171950 TGTGGGGCAGAGAACTCCACAGG - Exonic
972024629 4:34361708-34361730 TGTTTGGCCCAGAAATGAACTGG - Intergenic
976126464 4:81838335-81838357 TGTTTGGGGCAGAAGTGCACTGG + Intronic
979103608 4:116655441-116655463 TGTGTGGCACAGACCTCCACTGG + Intergenic
982402974 4:154988822-154988844 TGTTCTGTTCAGAACTGCAATGG + Intergenic
990804091 5:59638421-59638443 TGTTAGGCATAGAACTGCTCAGG - Intronic
994632653 5:102305203-102305225 TATTAGGAACAGGACTGCACAGG - Intergenic
995619653 5:114010555-114010577 TGTTTCACACAGAGCTGCACAGG + Intergenic
997766198 5:136506117-136506139 CACTCAGCACAGAACTGCACTGG - Intergenic
1005586357 6:27280013-27280035 TGTTCGGCAAAAAATTGCTCGGG + Intergenic
1006898526 6:37485379-37485401 GGTTCAGCTCTGAACTGCACAGG + Intronic
1011772148 6:90685449-90685471 TGTTAAGCACAGGAATGCACTGG - Intergenic
1016044740 6:139469399-139469421 TCTAAGCCACAGAACTGCACAGG - Intergenic
1018640163 6:165897969-165897991 TGGTCGGCAAAGGACCGCACGGG - Intronic
1019334583 7:476947-476969 TGCTGGGCTCAGCACTGCACAGG + Intergenic
1020509551 7:9036313-9036335 TGCTCTGCACAGAATTGCACTGG + Intergenic
1023549102 7:41349927-41349949 TGTTAGGAACCGGACTGCACAGG + Intergenic
1023721090 7:43095552-43095574 TGTTCAGCTCAGAACTTCCCAGG + Intergenic
1024161004 7:46675943-46675965 TTTAGGGCACAGAACTACACAGG + Intronic
1027255389 7:76427567-76427589 TGGGCCCCACAGAACTGCACAGG - Intronic
1032127802 7:129207197-129207219 TGTTCATCACACAAGTGCACCGG - Intronic
1033452672 7:141475593-141475615 TGTACACCACAGAACCGCACTGG + Exonic
1035704960 8:1668585-1668607 TGGTCCGCACAGAGCTGCTCTGG - Exonic
1039615391 8:38951216-38951238 TGTTCGGCACAGAACTGCACAGG - Intronic
1041110399 8:54477601-54477623 TGCTCGGTACAGAATTGCGCTGG - Intergenic
1042887158 8:73564797-73564819 TGTTCTGCCCATATCTGCACTGG + Intronic
1060221284 9:121765354-121765376 TGCCTGGCACAGAACTGGACAGG - Intronic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1192540863 X:71971543-71971565 TGTTGGGAACAGAGCTGCACTGG - Intergenic
1195291879 X:103437649-103437671 TGTTGTGCACAGCTCTGCACTGG - Intergenic
1195524300 X:105868735-105868757 TGTTCGCCACACAACTGTAAGGG + Intronic
1198241764 X:134794744-134794766 TTTTCAGAACTGAACTGCACTGG + Intronic