ID: 1039616451

View in Genome Browser
Species Human (GRCh38)
Location 8:38958438-38958460
Sequence TTAACAGGGAGTGACACTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039616451_1039616462 23 Left 1039616451 8:38958438-38958460 CCTCGAGTGTCACTCCCTGTTAA No data
Right 1039616462 8:38958484-38958506 TGGTCCGCTTTCCCATTTCTTGG No data
1039616451_1039616463 24 Left 1039616451 8:38958438-38958460 CCTCGAGTGTCACTCCCTGTTAA No data
Right 1039616463 8:38958485-38958507 GGTCCGCTTTCCCATTTCTTGGG No data
1039616451_1039616454 -3 Left 1039616451 8:38958438-38958460 CCTCGAGTGTCACTCCCTGTTAA No data
Right 1039616454 8:38958458-38958480 TAAGCAACCTCCCTTCCCCAAGG No data
1039616451_1039616455 3 Left 1039616451 8:38958438-38958460 CCTCGAGTGTCACTCCCTGTTAA No data
Right 1039616455 8:38958464-38958486 ACCTCCCTTCCCCAAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039616451 Original CRISPR TTAACAGGGAGTGACACTCG AGG (reversed) Intronic