ID: 1039616455

View in Genome Browser
Species Human (GRCh38)
Location 8:38958464-38958486
Sequence ACCTCCCTTCCCCAAGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039616451_1039616455 3 Left 1039616451 8:38958438-38958460 CCTCGAGTGTCACTCCCTGTTAA No data
Right 1039616455 8:38958464-38958486 ACCTCCCTTCCCCAAGGAGCTGG No data
1039616448_1039616455 23 Left 1039616448 8:38958418-38958440 CCGCTGCCCTTTCTTCTGGGCCT No data
Right 1039616455 8:38958464-38958486 ACCTCCCTTCCCCAAGGAGCTGG No data
1039616450_1039616455 16 Left 1039616450 8:38958425-38958447 CCTTTCTTCTGGGCCTCGAGTGT No data
Right 1039616455 8:38958464-38958486 ACCTCCCTTCCCCAAGGAGCTGG No data
1039616447_1039616455 24 Left 1039616447 8:38958417-38958439 CCCGCTGCCCTTTCTTCTGGGCC No data
Right 1039616455 8:38958464-38958486 ACCTCCCTTCCCCAAGGAGCTGG No data
1039616449_1039616455 17 Left 1039616449 8:38958424-38958446 CCCTTTCTTCTGGGCCTCGAGTG No data
Right 1039616455 8:38958464-38958486 ACCTCCCTTCCCCAAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039616455 Original CRISPR ACCTCCCTTCCCCAAGGAGC TGG Intronic