ID: 1039616457

View in Genome Browser
Species Human (GRCh38)
Location 8:38958468-38958490
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039616457_1039616462 -7 Left 1039616457 8:38958468-38958490 CCCTTCCCCAAGGAGCTGGTCCG No data
Right 1039616462 8:38958484-38958506 TGGTCCGCTTTCCCATTTCTTGG No data
1039616457_1039616463 -6 Left 1039616457 8:38958468-38958490 CCCTTCCCCAAGGAGCTGGTCCG No data
Right 1039616463 8:38958485-38958507 GGTCCGCTTTCCCATTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039616457 Original CRISPR CGGACCAGCTCCTTGGGGAA GGG (reversed) Intronic