ID: 1039616458

View in Genome Browser
Species Human (GRCh38)
Location 8:38958469-38958491
Sequence GCGGACCAGCTCCTTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039616458_1039616462 -8 Left 1039616458 8:38958469-38958491 CCTTCCCCAAGGAGCTGGTCCGC No data
Right 1039616462 8:38958484-38958506 TGGTCCGCTTTCCCATTTCTTGG No data
1039616458_1039616463 -7 Left 1039616458 8:38958469-38958491 CCTTCCCCAAGGAGCTGGTCCGC No data
Right 1039616463 8:38958485-38958507 GGTCCGCTTTCCCATTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039616458 Original CRISPR GCGGACCAGCTCCTTGGGGA AGG (reversed) Intronic