ID: 1039616462

View in Genome Browser
Species Human (GRCh38)
Location 8:38958484-38958506
Sequence TGGTCCGCTTTCCCATTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039616458_1039616462 -8 Left 1039616458 8:38958469-38958491 CCTTCCCCAAGGAGCTGGTCCGC No data
Right 1039616462 8:38958484-38958506 TGGTCCGCTTTCCCATTTCTTGG No data
1039616453_1039616462 8 Left 1039616453 8:38958453-38958475 CCTGTTAAGCAACCTCCCTTCCC No data
Right 1039616462 8:38958484-38958506 TGGTCCGCTTTCCCATTTCTTGG No data
1039616456_1039616462 -4 Left 1039616456 8:38958465-38958487 CCTCCCTTCCCCAAGGAGCTGGT No data
Right 1039616462 8:38958484-38958506 TGGTCCGCTTTCCCATTTCTTGG No data
1039616452_1039616462 9 Left 1039616452 8:38958452-38958474 CCCTGTTAAGCAACCTCCCTTCC No data
Right 1039616462 8:38958484-38958506 TGGTCCGCTTTCCCATTTCTTGG No data
1039616457_1039616462 -7 Left 1039616457 8:38958468-38958490 CCCTTCCCCAAGGAGCTGGTCCG No data
Right 1039616462 8:38958484-38958506 TGGTCCGCTTTCCCATTTCTTGG No data
1039616451_1039616462 23 Left 1039616451 8:38958438-38958460 CCTCGAGTGTCACTCCCTGTTAA No data
Right 1039616462 8:38958484-38958506 TGGTCCGCTTTCCCATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039616462 Original CRISPR TGGTCCGCTTTCCCATTTCT TGG Intronic