ID: 1039617298

View in Genome Browser
Species Human (GRCh38)
Location 8:38966297-38966319
Sequence CTTTGGGGATGGGGGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039617285_1039617298 5 Left 1039617285 8:38966269-38966291 CCTGATAGAATGCAAAGAGGAGG 0: 1
1: 0
2: 2
3: 18
4: 239
Right 1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039617298 Original CRISPR CTTTGGGGATGGGGGGATGA GGG Intronic
No off target data available for this crispr