ID: 1039617671

View in Genome Browser
Species Human (GRCh38)
Location 8:38969460-38969482
Sequence GGAAGCTCCAGCCTTTCAAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039617667_1039617671 -3 Left 1039617667 8:38969440-38969462 CCATTTCTTTGACCCGACCTGGA 0: 1
1: 0
2: 0
3: 26
4: 93
Right 1039617671 8:38969460-38969482 GGAAGCTCCAGCCTTTCAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 138
1039617665_1039617671 9 Left 1039617665 8:38969428-38969450 CCTTTTCTAGATCCATTTCTTTG 0: 1
1: 0
2: 3
3: 43
4: 556
Right 1039617671 8:38969460-38969482 GGAAGCTCCAGCCTTTCAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039617671 Original CRISPR GGAAGCTCCAGCCTTTCAAG TGG Exonic
900203453 1:1421280-1421302 GGCAGCTTCAGCCTTGCAGGGGG + Exonic
901352691 1:8611767-8611789 GAAAGGTGCAACCTTTCAAGGGG - Intronic
902264070 1:15248513-15248535 GGAAACTCCAGTCTTTTAAAAGG + Intronic
902580743 1:17405990-17406012 GGAAGCTCCAAGCTGCCAAGGGG + Intergenic
903960604 1:27054985-27055007 TGAAGCTCCAGAATATCAAGTGG - Intergenic
904122096 1:28205925-28205947 TGTAGATCCAGCGTTTCAAGAGG + Intronic
904953448 1:34263057-34263079 GGAAGCTACAGGCTTGCCAGTGG - Intergenic
904978061 1:34473549-34473571 AGGAGCTCCAGCCCTTAAAGAGG + Intergenic
905062503 1:35151783-35151805 TGAAGTTCCAGCCATTCAGGAGG - Intergenic
907448933 1:54529815-54529837 GGCTGCTACAGACTTTCAAGGGG - Intergenic
914419572 1:147516999-147517021 TGTAGCTCCAGCTTTTCAGGAGG - Intergenic
917526930 1:175796388-175796410 GGAAGAGCCAGCCTTTCAGGTGG - Intergenic
917537835 1:175887480-175887502 GGAAGCTGCTGCCTTTCGTGGGG - Intergenic
918122291 1:181550348-181550370 CCAAGCTCCAGCCTTTCTATAGG - Intronic
918689802 1:187466228-187466250 GGAAGCTGCAGAATTTCCAGGGG - Intergenic
922319049 1:224469200-224469222 TGAAGCTCCAGCTTCTCAAGAGG - Intronic
924428389 1:243974669-243974691 GGAAGCCTCAGGCTTCCAAGTGG + Intergenic
924501274 1:244640661-244640683 TGATCCTCCAGCCTTTCATGAGG + Intronic
1062929992 10:1346608-1346630 GCAGGCTCCAGCCTTTACAGAGG + Intronic
1063318970 10:5034532-5034554 GGGGGCTCCAGCCTTTCAGCAGG - Intronic
1063715598 10:8523488-8523510 AAAAGCTCCAGACTTTGAAGAGG - Intergenic
1066025367 10:31352758-31352780 AGAAGCTGCAGCCTTTTAAAGGG + Intronic
1067186183 10:44029899-44029921 GGCAGCTCCTGCCTTGCCAGGGG + Intergenic
1067572840 10:47384391-47384413 GGAAGCTCCAGCCTTCGGGGCGG + Intergenic
1067786612 10:49254938-49254960 GGAGGCTCCAGCCAGTGAAGGGG - Intergenic
1069140542 10:64817468-64817490 GGAAGCTCCAACCTTACCAGTGG + Intergenic
1069693989 10:70373651-70373673 TGAAGCTCAAGACTTTCATGTGG - Intronic
1072708776 10:97701898-97701920 GGAACCTCAAACGTTTCAAGAGG - Intergenic
1073425159 10:103451691-103451713 GGAAGCTCCAGGCTGTGAAGTGG - Intronic
1073994409 10:109299275-109299297 ATAAGCTCCAGACTTTGAAGAGG - Intergenic
1079019527 11:16897645-16897667 GGAACTACCAGCCTTTCACGTGG - Intronic
1079348143 11:19670689-19670711 GGAAGGCCCAGGCTTTGAAGCGG + Intronic
1080502879 11:32887160-32887182 GGAAGCTGCAGCCTCACTAGGGG - Intergenic
1082057999 11:47835869-47835891 GAAAGGTCCATCCTTTCAAAAGG - Intronic
1083758968 11:64805616-64805638 TGGAGCTCCAGCCTTTCACCTGG + Exonic
1088446612 11:109937045-109937067 GGAAGCCACAGCCTCTTAAGGGG - Intergenic
1088842598 11:113639420-113639442 GGGAGCACCAGCATTTCAGGAGG + Intergenic
1090347705 11:126084352-126084374 CGAAGTCCCAGCCTTTCAATAGG - Intergenic
1093387554 12:18577091-18577113 GGAAGCAGCAGACTTTCAATAGG + Intronic
1097923197 12:65099399-65099421 TGATGCTCCTGCCTTTGAAGTGG + Intronic
1098821269 12:75232891-75232913 GGAAGGTGCATCCTTTCTAGAGG - Intergenic
1101289562 12:103353813-103353835 GGAACCACCAGCCCTTCACGAGG + Intronic
1104389079 12:128376015-128376037 GGAAGCTTCAGAGTTTCAAGCGG + Intronic
1107430746 13:40338208-40338230 CTAAGCTCCAGCCTTGCAGGTGG + Intergenic
1108290939 13:48960134-48960156 TAAAGCTCCAGCCTTAGAAGAGG + Intergenic
1108721338 13:53135876-53135898 GGAAGCCCAAGCCTTTCAGGGGG + Intergenic
1120059560 14:79966464-79966486 GGAAGCCCAAGCAGTTCAAGGGG - Intergenic
1123634768 15:22293166-22293188 GAAAGGTGCAACCTTTCAAGGGG + Intergenic
1125992315 15:44121620-44121642 GGTATCTCCAGGCTTTAAAGGGG + Intronic
1133517477 16:6523470-6523492 GGCAGCTCCAGTCTTTCAGTGGG + Intronic
1135179362 16:20259513-20259535 GGGAACTTCAGCCTTTCAAAGGG + Intergenic
1136541534 16:30930137-30930159 AGAAGCTAGAGCGTTTCAAGCGG + Exonic
1139671287 16:68493648-68493670 TGAAGCCCCAGCCATTCAATGGG + Intergenic
1141180901 16:81752782-81752804 GGAAGCTCCAGCCTAGCACTGGG + Intronic
1144306849 17:13976517-13976539 AGAAGCTACAGTCTTTCAAAGGG - Intergenic
1144468146 17:15513457-15513479 GGAAGCTCCAGCCTGAGATGGGG + Intronic
1146503953 17:33388479-33388501 GGAAGTTCCAGCCATCCCAGAGG + Intronic
1146948349 17:36889182-36889204 GGAGGCTCCAGCCTCTCAGGAGG - Intergenic
1148563920 17:48621973-48621995 AGAAGCTACAGTCTGTCAAGTGG + Exonic
1152905800 17:82970273-82970295 GGAAACTGCAGCCTCTCAGGGGG - Intronic
1155861941 18:30912299-30912321 GGAAACCCCAGCCTTTTAAAAGG + Intergenic
1156268351 18:35508468-35508490 GGAAGCATCTGCCTTTTAAGAGG - Intergenic
1161774213 19:6249620-6249642 GGGGGCTCCAGCTCTTCAAGGGG - Intronic
1164172772 19:22739905-22739927 GGAAGCTCAAGTATTTGAAGTGG - Intergenic
1164572639 19:29385356-29385378 GGCACCCCCAGCCCTTCAAGAGG - Intergenic
1164665877 19:30036434-30036456 GGCAGCTCCTGCCTTCCATGTGG - Intergenic
1165151671 19:33764161-33764183 GAAAGCACCAGCCTTTCCACAGG + Intronic
1167019701 19:46863876-46863898 GGAAGCTGGAGCCTTTCCCGGGG - Intergenic
926216166 2:10906867-10906889 GGGAGGTCCAGCCTGTCCAGTGG - Intergenic
926882416 2:17561386-17561408 AGAAGCTCCAGTTTTTCAACAGG - Intronic
931385239 2:61792621-61792643 GGAAGTTGCAGCCCTTCCAGCGG + Intergenic
937767813 2:125681548-125681570 GAAAGCTACAGCCTTACAAATGG - Intergenic
941465723 2:165824156-165824178 GGAAGATCCTGCTTTTGAAGTGG - Intergenic
945646211 2:212498227-212498249 TGAACCTCCAGTCTTTCAAATGG + Intronic
946448595 2:219760942-219760964 GAAGGATCCAGCCTCTCAAGAGG - Intergenic
947523291 2:230864506-230864528 GGAGGCTCCAGCGTTTCTAAAGG + Intergenic
947825329 2:233102324-233102346 GGAAGCTGCTGCCTTTGAAGGGG + Intronic
948268163 2:236653821-236653843 GGAAGTTCCACCCTTGAAAGAGG - Intergenic
949045868 2:241872419-241872441 GGGAGCCCCGGCCTTTGAAGAGG - Exonic
1172123357 20:32611231-32611253 GCAATCTCCAGCCTTTCCACGGG - Intergenic
1172357486 20:34290306-34290328 AGAAGCTCCCGCCTTGCCAGTGG - Intronic
1174316477 20:49706542-49706564 GGTAGCTCCAGGATTTTAAGTGG + Intronic
1179062166 21:37989176-37989198 TGAGGCACCAGCCATTCAAGAGG + Intronic
1179563348 21:42231129-42231151 GGAAGCTGGAGCCTCTCCAGAGG - Intronic
1180579203 22:16813387-16813409 GGAACCCCCAGCCTTTTAAAGGG - Intronic
1181045127 22:20210742-20210764 GGAAGCCCCAGCCTTCCAGAAGG - Intergenic
1185286128 22:50000656-50000678 CTAAGCTCCAGCCATGCAAGTGG - Intronic
950662184 3:14473422-14473444 GCAAGCTCCAACCTCTCAGGGGG - Intronic
955807517 3:62753068-62753090 GGAAGCACAAGCCCTTCAACTGG + Intronic
957460554 3:80513290-80513312 GGAAGATACTGCCTCTCAAGGGG + Intergenic
957676089 3:83366858-83366880 GCCAGGTCTAGCCTTTCAAGTGG + Intergenic
958854408 3:99367253-99367275 GGAAGCAATAGCCTATCAAGTGG - Intergenic
961012326 3:123444719-123444741 GAGAGGTCCAGCCTTGCAAGAGG + Intronic
961236915 3:125375145-125375167 GGCAGCTCCAACCTTTCTAGGGG + Exonic
962080154 3:132129965-132129987 GGATGCTCCAGCCTGGCAAATGG + Intronic
962626172 3:137227952-137227974 AGAAGGTCCAGCCTTTCACAGGG + Intergenic
968481903 4:836974-836996 GGAAACTGCAGCCTCCCAAGCGG - Intergenic
968620956 4:1603295-1603317 GGAAGAGCCAGACCTTCAAGGGG + Intergenic
969704397 4:8784082-8784104 GGAAACTTCAGCCTCTCAACTGG - Intergenic
970737881 4:19195834-19195856 GGAAGCTCTAGACTTTCATCTGG + Intergenic
973702485 4:53550927-53550949 GGGCGTTCCAGGCTTTCAAGTGG - Intronic
974043458 4:56877772-56877794 TCAAGCTTCAGCCTCTCAAGTGG + Intergenic
976798053 4:88956957-88956979 GATAGCTCAAGCCATTCAAGAGG - Intronic
977572679 4:98645934-98645956 GAAAACCCCAGCCCTTCAAGGGG - Intronic
982338669 4:154270357-154270379 GGAAGCACCAGACTTTAGAGAGG + Intronic
982466832 4:155742419-155742441 GGAACCTCCAGCCTTTTACCAGG - Intergenic
982600740 4:157444643-157444665 GTAAACTCCAGCTCTTCAAGTGG - Intergenic
985355583 4:189115964-189115986 TGTAGTTCCAGCCATTCAAGAGG + Intergenic
987204302 5:15609348-15609370 TGAGGCTTCAGCCTTTGAAGTGG + Intronic
988913706 5:35871356-35871378 GGAAGATCCAGGTTTTCATGGGG - Intronic
988994721 5:36703745-36703767 GGAAAATCCAGCCTTTTCAGTGG - Intergenic
991667592 5:69014619-69014641 AGAAACTCAAGCCTTTGAAGAGG - Intergenic
994933048 5:106214365-106214387 TGAAGCTCCAATCTTTCCAGTGG - Intergenic
995932445 5:117464026-117464048 GGCTGCTCCATCCTGTCAAGTGG + Intergenic
999395031 5:151221867-151221889 GGGAGCTCATGCCTTCCAAGGGG + Intronic
1001948607 5:175800250-175800272 GGAAGCCCCTGCCTATCAAATGG + Intronic
1003183449 6:3811024-3811046 GGAAGCTACAGCCTTTTGGGAGG + Intergenic
1006430701 6:33993851-33993873 GGAAGCTGCAGCCTCTAGAGAGG - Intergenic
1006627142 6:35405453-35405475 TGAAGCTCCAGCCTCTTAAGTGG + Intronic
1008765545 6:54909331-54909353 GGAATCTACAGCATTCCAAGAGG - Intronic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1017899950 6:158711110-158711132 GCAAGAACCAGCCTTTCAAATGG - Intronic
1017973957 6:159338122-159338144 GGCAGCCCCACCCTTTCCAGTGG + Intergenic
1018678677 6:166244864-166244886 GGAAGCCCCGGGCTTTCATGTGG - Intergenic
1019072882 6:169364059-169364081 CGGAGCTCCAGCTTTTCCAGGGG - Intergenic
1021593945 7:22294618-22294640 GGAAACTCCATCCTTCCAACTGG + Intronic
1021625600 7:22590034-22590056 CAAAGCTCCAGCCTTTCCAGAGG + Intronic
1021965773 7:25916438-25916460 GGATGCTCCATCCTATGAAGGGG + Intergenic
1031792302 7:126121570-126121592 GGTTTCTCCAGTCTTTCAAGAGG + Intergenic
1033468497 7:141620940-141620962 GTCAGCTCCAGCCTTGCATGTGG + Intronic
1036048060 8:5166076-5166098 GGAAGCTTCAGTATTTAAAGGGG + Intergenic
1036237032 8:7047860-7047882 GAAAGATACAGCATTTCAAGTGG - Intergenic
1038499493 8:28031722-28031744 TCAAGTTCCACCCTTTCAAGTGG - Intronic
1039617671 8:38969460-38969482 GGAAGCTCCAGCCTTTCAAGTGG + Exonic
1040637160 8:49288547-49288569 GGAAGCCCCTTCCTTTCCAGTGG - Intergenic
1041936078 8:63332961-63332983 TAAAGCTCCAGCCCTTCAAATGG + Intergenic
1042550588 8:69990949-69990971 GGTAGCCCCAGCTTCTCAAGAGG + Intergenic
1044769779 8:95618897-95618919 TTATGCCCCAGCCTTTCAAGGGG + Intergenic
1047672944 8:127169000-127169022 GCAAGCTCCAGCCTTCCAAATGG - Intergenic
1048539812 8:135332651-135332673 GGCAGCTCCAGCGTTTCTACAGG + Intergenic
1049337180 8:142092640-142092662 GGAAGCTCCTGTCTTTCTCGGGG + Intergenic
1050569600 9:6923928-6923950 GGCTGCTGCAGCCTTTCAGGTGG + Intronic
1054927687 9:70604603-70604625 GGAAGCTGCAGCCTTGCTGGGGG + Intronic
1056618110 9:88186009-88186031 GGGAGCACCAGCCTGTCCAGTGG + Intergenic
1057330750 9:94112704-94112726 GGAAGGTGCAGCCTTTTAGGAGG + Intergenic
1058012644 9:99995480-99995502 GGAAACTTCAGTCTTTCAAAGGG - Intronic
1060988962 9:127837452-127837474 GGTACCTCCAGCCTTTCTGGTGG + Intronic
1062049780 9:134441254-134441276 GGAAGTCCCTGCCTTTCAGGTGG - Intergenic
1062380176 9:136283385-136283407 TGAAGCTCCAGCCCCTCAAGTGG + Intronic
1062718428 9:138022757-138022779 GAAAGCACCAGCCTGTCAGGAGG - Intronic
1187591265 X:20719966-20719988 GGAAGCTCCAGACATTCAAAAGG + Intergenic
1191860024 X:65658677-65658699 AGAAGCTTCTGCATTTCAAGTGG - Intronic
1192830352 X:74744764-74744786 GGAAAGTCAAGGCTTTCAAGGGG + Intronic