ID: 1039617751

View in Genome Browser
Species Human (GRCh38)
Location 8:38969791-38969813
Sequence CAGTGCCATGGGAGGGAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 837
Summary {0: 1, 1: 0, 2: 11, 3: 85, 4: 740}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039617744_1039617751 -2 Left 1039617744 8:38969770-38969792 CCTCTGATGTGTGATGGAGCACA 0: 1
1: 0
2: 4
3: 11
4: 123
Right 1039617751 8:38969791-38969813 CAGTGCCATGGGAGGGAGGGAGG 0: 1
1: 0
2: 11
3: 85
4: 740
1039617742_1039617751 21 Left 1039617742 8:38969747-38969769 CCTTGATGATGAAAACATACGGA 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1039617751 8:38969791-38969813 CAGTGCCATGGGAGGGAGGGAGG 0: 1
1: 0
2: 11
3: 85
4: 740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039617751 Original CRISPR CAGTGCCATGGGAGGGAGGG AGG Exonic
900124113 1:1062051-1062073 CGGGGACAAGGGAGGGAGGGAGG - Intergenic
900319659 1:2076279-2076301 CCCTGCCATGTGAGGGAGGTGGG - Intronic
900469932 1:2848793-2848815 CTGTGCCCTGGGTGGGAGTGAGG + Intergenic
900469942 1:2848825-2848847 CCGTGCCTTGGGTGGGAGTGTGG + Intergenic
900469956 1:2848888-2848910 CTGTGCCCTGGGTGGGAGTGTGG + Intergenic
900470014 1:2849110-2849132 CTGTGCCCTGGGTGGGAGTGTGG + Intergenic
900470024 1:2849142-2849164 CTGTGCCCTGGGCGGGAGTGTGG + Intergenic
900470034 1:2849174-2849196 CTGTGCCCTGGGCGGGAGTGTGG + Intergenic
900470044 1:2849206-2849228 CCGTGCCCTGGGCGGGAGTGTGG + Intergenic
900470063 1:2849269-2849291 CTGTGCCCTGGGTGGGAGTGTGG + Intergenic
900470073 1:2849301-2849323 CTGTGCCCTGGGTGGGAGTGTGG + Intergenic
900470143 1:2849554-2849576 CTGTGCCCTGGGCGGGAGTGTGG + Intergenic
900470170 1:2849650-2849672 CTGTGCCCTGGGCGGGAGTGTGG + Intergenic
900470179 1:2849682-2849704 CTGTGCCCTGGGTGGGAGTGTGG + Intergenic
900562628 1:3315023-3315045 CAGGGGCTGGGGAGGGAGGGTGG - Intronic
900589480 1:3453414-3453436 CCATCCCCTGGGAGGGAGGGTGG - Intergenic
900735679 1:4298096-4298118 CAAGGGCATTGGAGGGAGGGAGG + Intergenic
900958083 1:5900532-5900554 TAGTGCCAGGGGAGGAGGGGAGG + Intronic
901053224 1:6436122-6436144 CTGTGCGGTGGGAGGGAGGGAGG + Intronic
902306920 1:15547895-15547917 CAGTGACATGAGAGGTAGTGGGG - Intronic
902339326 1:15772449-15772471 CATGCCCATGAGAGGGAGGGGGG + Intronic
902481028 1:16711965-16711987 CTGTGCAGTGGGAGGGAGGGAGG - Intergenic
902667040 1:17946724-17946746 CAGAGAGATGGGAGGGATGGGGG + Intergenic
902974649 1:20080151-20080173 CAGTGTGGTGGGTGGGAGGGAGG + Intronic
903299498 1:22368598-22368620 CTGGGCCATGTGTGGGAGGGTGG + Intergenic
903572211 1:24314371-24314393 AAGGGAGATGGGAGGGAGGGAGG - Intergenic
904246829 1:29193982-29194004 GAGTGACATGGGAGGGGAGGCGG - Exonic
904277812 1:29395611-29395633 TCGTGACCTGGGAGGGAGGGAGG - Intergenic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904756402 1:32770951-32770973 CAGGCCCTTGGGAGGGAGGGTGG - Exonic
905894095 1:41534120-41534142 CAGTGGTATAGGAGAGAGGGTGG - Intronic
905901667 1:41585511-41585533 CACTGACATGGGAGCGGGGGAGG - Intronic
906141307 1:43535365-43535387 CAGGGCCCAGGGAGGGTGGGAGG - Intronic
906194348 1:43920597-43920619 AAGTGCCTTGGAAGGAAGGGTGG + Intronic
906282427 1:44563408-44563430 CAGGGCCAAGGGAGGGAAGCGGG - Intronic
906290209 1:44614779-44614801 CAGGGACAAGGGAGGGAGGCTGG - Intronic
906399551 1:45494988-45495010 CAGGGCCTTGGAGGGGAGGGTGG + Intronic
906680100 1:47720445-47720467 CAGTGCAGTGGGAGGGACAGGGG - Intergenic
907366100 1:53961437-53961459 CACTTCCCTGGGAGGTAGGGAGG - Intronic
907658960 1:56374259-56374281 CAGTGCCGTGGAAGGGAAGTTGG - Intergenic
908089176 1:60668755-60668777 CTGTCCACTGGGAGGGAGGGAGG - Intergenic
910207126 1:84759310-84759332 CAGGGCCACGGGAAGGAGGTGGG - Intergenic
910439478 1:87238151-87238173 AAGTTCCATGGGAGATAGGGTGG + Intergenic
912799433 1:112711900-112711922 CAGGGCCATGGGGTGCAGGGAGG + Intronic
914263998 1:146021927-146021949 GAGTGCCAAGTCAGGGAGGGAGG + Intergenic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914406777 1:147382809-147382831 CAGTGACCTGGGAGGGAGCGAGG - Intergenic
914858724 1:151370002-151370024 CAGGGCCCCGGGAGGGTGGGAGG + Intronic
914877927 1:151526118-151526140 CAGTGCTTTGGGAGGCAAGGTGG - Intronic
915296206 1:154923586-154923608 CAGTTCTCTGGGAAGGAGGGTGG - Intergenic
915511929 1:156391254-156391276 CCCTGCCAGGGGAGGGTGGGTGG + Intergenic
916074836 1:161194215-161194237 CAGTGCCCTGGGAAGGGGGTTGG + Exonic
916713316 1:167431108-167431130 CAGGGGCATGGGAAGGTGGGCGG - Exonic
917348839 1:174056490-174056512 CACAGGAATGGGAGGGAGGGTGG + Intergenic
917522924 1:175762953-175762975 CAGTGCCTTCAGAGGGAGCGTGG + Intergenic
917817605 1:178725859-178725881 CAGGGCCAGGGGAGGGGGTGTGG - Intronic
917921179 1:179751222-179751244 GAGTGCCTAGGGAGAGAGGGTGG + Intronic
918025857 1:180745309-180745331 CAGTGGAACAGGAGGGAGGGAGG + Intronic
918284915 1:183042800-183042822 CAGTGCCAGGAGAGGGCTGGGGG - Intronic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919705345 1:200670024-200670046 CAGTGGCTTGGGAGGGAGGGAGG + Intergenic
920055256 1:203186457-203186479 CAGAGCCAGGGGAGGGACTGAGG - Intronic
920186512 1:204162653-204162675 CAGTGCCATGGGAGGCCGCTAGG + Intronic
920472876 1:206247022-206247044 CAGAACCGTGGGAGGGAGGAGGG + Intronic
920669702 1:207993855-207993877 GAGAGCCATCGGAGGGAGTGCGG + Intergenic
920950806 1:210570252-210570274 CAGAGCCATGGGAGGGGGCTCGG + Intronic
922209416 1:223476169-223476191 AAGAACCATGGGAGGGAGAGGGG - Intergenic
922406704 1:225321820-225321842 CAGAGTCAGGGGAGGAAGGGTGG - Intronic
922726863 1:227926785-227926807 CAGGGCCATGTGAGGGTGTGGGG - Intronic
922987613 1:229878129-229878151 AAGTGGAGTGGGAGGGAGGGAGG + Intergenic
923843321 1:237698655-237698677 CAGTGAGATGGGAGGGAGAGGGG + Intronic
924037346 1:239950661-239950683 CACTGCCGAGGGAGGGAGGAAGG - Intergenic
924052826 1:240093788-240093810 CAGAGCCCAGGGAGGGCGGGTGG - Intronic
924172663 1:241357505-241357527 CTGTGCGATGGGTGGGTGGGTGG + Intergenic
924261370 1:242234811-242234833 GAGTGCAGTAGGAGGGAGGGAGG + Intronic
924270378 1:242326121-242326143 CAGCACTTTGGGAGGGAGGGGGG - Intronic
1062997192 10:1877531-1877553 CTGGGCCATGGGAGGGGGGGTGG + Intergenic
1063086433 10:2822452-2822474 CAGAGCCATGTGATGCAGGGTGG - Intergenic
1063382229 10:5592674-5592696 CAGTGCCATGGAAGGAGGGGAGG + Intergenic
1064232798 10:13544260-13544282 AAGGGGCATGGGAGGGAGAGGGG + Intergenic
1064341649 10:14491003-14491025 CAGTGACTTGGGAGGGAGGAGGG + Intergenic
1064607768 10:17061643-17061665 CCCTGCCCTGGGAAGGAGGGAGG + Intronic
1064798313 10:19039329-19039351 GACTACCATAGGAGGGAGGGAGG + Intergenic
1065815642 10:29480255-29480277 CAGGGGCAGGGGAGGGAGAGAGG + Intronic
1065817276 10:29493591-29493613 CAGTAAAATGGGAGAGAGGGAGG + Intronic
1065957289 10:30704949-30704971 CAGGGGCAGGGGAGGGAGAGAGG - Intergenic
1066067378 10:31772198-31772220 CAGTGCCAAGGGAGAGCAGGAGG + Intergenic
1066459156 10:35597995-35598017 CAGTGCCATTGCAGGGTCGGGGG + Intergenic
1066714553 10:38272681-38272703 CAGCACTTTGGGAGGGAGGGGGG + Intergenic
1066756954 10:38721136-38721158 CAGTACCTTGGAAGGGAGGCGGG - Intergenic
1066783519 10:38978029-38978051 CAGCACTTTGGGAGGGAGGGGGG - Intergenic
1067033733 10:42898260-42898282 CAGAACCGTGGGACGGAGGGCGG + Intergenic
1067090758 10:43264849-43264871 CTGTGCCAAGGCAGGGATGGGGG - Intronic
1067227760 10:44386551-44386573 CAGTGCCCAGGGTGGGTGGGTGG - Intergenic
1067250885 10:44586460-44586482 GTGTGGCAAGGGAGGGAGGGTGG + Intergenic
1067266540 10:44750326-44750348 CACTGCCAAGGGCTGGAGGGAGG + Intergenic
1067582962 10:47457086-47457108 CGGTGCCAAGGCAGTGAGGGTGG + Intergenic
1069629815 10:69890591-69890613 CACTGCCAGGGCATGGAGGGAGG + Intronic
1069633005 10:69908935-69908957 AGATGCCTTGGGAGGGAGGGAGG + Intronic
1069815516 10:71191472-71191494 CTTTGCCATGGGAGGGGGGCAGG - Intergenic
1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG + Intronic
1070525575 10:77293160-77293182 CAATGCCATGGGAAGGAGTTTGG + Intronic
1070639918 10:78160835-78160857 CAGTGACATGGGAGGGATAGTGG - Intergenic
1070698030 10:78577535-78577557 CAGTGCCCAGGGAGGCATGGAGG - Intergenic
1070701044 10:78601975-78601997 CAGTGCCAGGAGAGGCAGGCAGG - Intergenic
1071223523 10:83498232-83498254 CAGTGCCATGAGAAGTAGAGGGG + Intergenic
1072176958 10:92935804-92935826 CAGTGCAATAGGACTGAGGGTGG - Exonic
1072698172 10:97619709-97619731 CAGTGTCATGGAATGGCGGGAGG + Intronic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1073073815 10:100810854-100810876 CAGGGCCATGGGGGGGAGGCGGG - Intronic
1073077324 10:100832317-100832339 AGGTGCCAGGGGAGGGGGGGGGG + Intergenic
1073154463 10:101335493-101335515 CCTGGCCATGGAAGGGAGGGTGG + Intergenic
1073439481 10:103544150-103544172 CAGAGCCAGGGGAGGGAAGGAGG + Intronic
1074192191 10:111147730-111147752 GGGTGCCATGGGAGATAGGGTGG - Intergenic
1074212267 10:111346488-111346510 CAGTGCAATGGGAGAAAGGTTGG - Intergenic
1074979543 10:118608615-118608637 CAGTGCCAGGAGAGGATGGGAGG + Intergenic
1075023207 10:118966225-118966247 AGGTGCCAGGGGAGGGAGGCTGG + Intergenic
1075133209 10:119758298-119758320 CAGGGCCAGGGGTGGGAGCGGGG + Intronic
1075194851 10:120347698-120347720 CACTGCCAGGGGATGGAGGCGGG - Intergenic
1075345972 10:121682081-121682103 TACTGCCAGGAGAGGGAGGGGGG + Intergenic
1075721256 10:124588881-124588903 CAGTGCCCTGGGAATGAGGAAGG + Intronic
1075856926 10:125637773-125637795 CTGTGCCATGAGATGGATGGGGG - Intronic
1075880560 10:125847221-125847243 CCATACCATGGAAGGGAGGGAGG + Intronic
1075919843 10:126201492-126201514 CAGAGCCTTGGGAGGGAACGTGG + Intronic
1076081618 10:127586777-127586799 CAGTGTCCTGGGATGGAGGTGGG + Intergenic
1076445938 10:130513821-130513843 CTGTGCCATGTGTGGGACGGAGG + Intergenic
1076459769 10:130633918-130633940 CCGTGCCATGACAGGGAGGGAGG - Intergenic
1076536819 10:131183740-131183762 CACTCCCATGGTGGGGAGGGGGG + Intronic
1076690819 10:132223114-132223136 CAGGGCCACGCGAGGAAGGGTGG + Intronic
1076730105 10:132434173-132434195 CAGTGGCAGGGACGGGAGGGTGG + Intergenic
1076863860 10:133157894-133157916 CAGGGCCTGGGCAGGGAGGGAGG + Intergenic
1077123607 11:922488-922510 CCCTGCCATGGAAGGGTGGGAGG - Intergenic
1077130889 11:971930-971952 CAGTGCCCTGGGTGCGTGGGTGG + Intronic
1077183856 11:1227881-1227903 TGGTGCCATTGGAGGGAGGCCGG + Intronic
1077214014 11:1387731-1387753 CAGGGCCAAGGGAGGCTGGGAGG + Intergenic
1077413959 11:2415863-2415885 CAGTGCCATGATGGGGAGGTGGG + Intronic
1078730163 11:13966204-13966226 TATTGCCGTTGGAGGGAGGGGGG - Intronic
1079939499 11:26660741-26660763 CAGTGTAATGGGAAAGAGGGTGG + Exonic
1080443698 11:32318084-32318106 CAGTGCCCTGCCAGGGAGAGAGG - Intergenic
1080592770 11:33737721-33737743 GAACGCCATAGGAGGGAGGGTGG + Intergenic
1080890038 11:36401323-36401345 AAGGGCCATGGCAGGGAGGGAGG + Intronic
1081604756 11:44520354-44520376 CAGGGCCGTGGGAGGGGCGGCGG - Intergenic
1081611738 11:44567071-44567093 CAGGGACATGGTAGGGATGGGGG - Intronic
1081633859 11:44707722-44707744 CATTGCCATGGGAAGCAAGGAGG + Intergenic
1081754212 11:45533021-45533043 CAGGCCCAAGGGAGGCAGGGAGG - Intergenic
1081772142 11:45656716-45656738 CAGTGCCTGGGGGGGGAGGGTGG - Intronic
1081881379 11:46455826-46455848 CAGTGTCATGGGAGGAAGGAAGG - Intronic
1082101071 11:48173440-48173462 GAGTGCCGTGGGAGGGGGGCTGG - Intergenic
1082847541 11:57738776-57738798 TAGTGCAAAGGGAGGGATGGTGG + Intronic
1083259109 11:61513640-61513662 TGGTGGCATGGGAGGCAGGGAGG - Intergenic
1083302249 11:61745320-61745342 CAGTGCCCTGGGTGGAAGGAAGG + Exonic
1083384851 11:62300036-62300058 CACGGCAATGGGAGGGAAGGCGG - Intergenic
1083682447 11:64357807-64357829 CAGTGCCCTGGGAGAGGGTGGGG - Intergenic
1083855200 11:65389804-65389826 CAGTACCGCAGGAGGGAGGGAGG + Intronic
1083878362 11:65536558-65536580 CAGTGGCATGAGAGAGAGGTGGG - Intronic
1084084730 11:66849797-66849819 CAGATCCAGGGGAGGGAGGGAGG + Exonic
1084368608 11:68721269-68721291 CTGTGGCAAGAGAGGGAGGGTGG - Intronic
1084431864 11:69115753-69115775 CGGTGCCAGGACAGGGAGGGCGG + Intergenic
1084912734 11:72404265-72404287 CAGTGCCAAGAAAGGGAGGAGGG + Intronic
1085511195 11:77089015-77089037 CAGGTCCCTGGGAGGGAGGGGGG - Intronic
1085525075 11:77159405-77159427 CAGCATCAGGGGAGGGAGGGTGG - Intronic
1085615515 11:77994983-77995005 CGGCGCGAAGGGAGGGAGGGAGG + Intergenic
1086025759 11:82289152-82289174 CAGTGTCATGGGCGGGAGAGAGG + Intergenic
1086401902 11:86467831-86467853 TTGCTCCATGGGAGGGAGGGGGG - Intronic
1088500480 11:110477832-110477854 CAGTACCATGGTTAGGAGGGCGG + Intergenic
1088550775 11:111010324-111010346 CAGGGCCACGAGAGGGAGGCTGG + Intergenic
1089253026 11:117178942-117178964 CAGGGCCGTGAGAAGGAGGGCGG - Exonic
1089498513 11:118919620-118919642 CAGTGCAGTGAGAGAGAGGGAGG - Intronic
1089556940 11:119320221-119320243 CACCACCATGGGAGAGAGGGAGG + Intronic
1089604825 11:119635752-119635774 CAGAGCCCGGGGAGGGAAGGCGG + Intronic
1089611499 11:119672030-119672052 CAGTGTCCTGGAAGGGAGGCAGG - Intronic
1090071579 11:123548984-123549006 CACTGCCATGAGGGGGTGGGAGG - Intronic
1090251397 11:125254340-125254362 CAGCCCCATGGCAGGGAGGTGGG - Intronic
1090605915 11:128422838-128422860 CAGTGCCATGGGAGGGGGAGGGG + Intergenic
1090645682 11:128765044-128765066 CAGGGCCGGGGGAGGGAGAGAGG + Intronic
1090878892 11:130815936-130815958 CACTGCCATGGGGCGGGGGGCGG - Intergenic
1091093397 11:132793750-132793772 TAGTCCCATGGGAGAGATGGGGG - Intronic
1091286814 11:134412430-134412452 CGGTGCCGGGGGAGGGTGGGGGG - Intergenic
1091754323 12:3041692-3041714 CCTCCCCATGGGAGGGAGGGAGG - Intergenic
1092280361 12:7093209-7093231 CAGGCCCCTGGGAGGGAGGAGGG + Intronic
1092323120 12:7500078-7500100 CAGTCCTATGGGAGAGAGAGAGG + Intronic
1094494683 12:30982042-30982064 CAGTGCCATGGGCGGGTCTGGGG + Intronic
1095292612 12:40492814-40492836 CACTGCCATAGGAGGGAGGATGG - Intronic
1095983347 12:47984853-47984875 CTGTGCCATGGGTGGCAGTGGGG - Intronic
1095989617 12:48025624-48025646 CAGACCCAAGGGAGGGAAGGAGG - Intergenic
1096245672 12:49984215-49984237 CAGCTCCCTGGGAGGAAGGGAGG + Intronic
1096978061 12:55711229-55711251 CAGCACTTTGGGAGGGAGGGAGG + Intronic
1097071711 12:56360075-56360097 CAGAGCCATTGGAGGGCGCGGGG - Intronic
1097084136 12:56454834-56454856 GAGAGCCATGGCAGTGAGGGTGG + Intronic
1097170969 12:57112439-57112461 CCCTGCTATGGGAGGGAGGAGGG - Intronic
1097222124 12:57457131-57457153 CAGGGACTAGGGAGGGAGGGAGG + Exonic
1097697144 12:62785987-62786009 CACTTCCCTGGGAGGTAGGGTGG + Intronic
1098580118 12:72089680-72089702 GAGTGCAATGGGTGGGAAGGTGG - Intronic
1099813127 12:87610853-87610875 CAGTACCATGGAAGGGAGGGTGG + Intergenic
1100270587 12:93020808-93020830 CAGTGAAATGTGAGGGAGTGGGG - Intergenic
1101308756 12:103556980-103557002 CAGAGCCTTTGGAGGGAGTGTGG + Intergenic
1101513713 12:105415396-105415418 AAGTGCCTTGGGAGGTAGGTTGG - Intergenic
1102002055 12:109563489-109563511 CAGTGCCAAGGCTGGGTGGGAGG + Intronic
1102177913 12:110889586-110889608 GAGAGACATGGGAGGGAGAGGGG + Intronic
1102460433 12:113096625-113096647 ATGTGGCAGGGGAGGGAGGGAGG + Intronic
1102641694 12:114372552-114372574 CAGTGCTTTGGGAGGCAGAGGGG - Intronic
1102932989 12:116876653-116876675 CGGAGGCGTGGGAGGGAGGGAGG - Intronic
1102960106 12:117086982-117087004 CTGGGCCTTGGGAGGGAGGCAGG + Intronic
1103021978 12:117541318-117541340 TGGAGGCATGGGAGGGAGGGAGG + Intronic
1104090704 12:125514743-125514765 CAGGACCAGGGAAGGGAGGGAGG - Intronic
1104860288 12:131919862-131919884 CAGGGCTGTGGCAGGGAGGGAGG + Intronic
1104931222 12:132340487-132340509 CACTGCCAAGGGAGGGCGGGAGG - Intergenic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984121 12:132587097-132587119 CAGTGCAGCTGGAGGGAGGGCGG + Intergenic
1104984147 12:132587208-132587230 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984183 12:132587364-132587386 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1106647442 13:31651505-31651527 CAGGGCCATGTGAGGGAAGAGGG - Intergenic
1109552156 13:63917766-63917788 GACAGACATGGGAGGGAGGGAGG - Intergenic
1109746778 13:66634231-66634253 CAGTCTGATGGGAGGGAGAGTGG + Intronic
1110831897 13:80041417-80041439 CTTGGGCATGGGAGGGAGGGAGG - Intergenic
1111885127 13:94011126-94011148 CAGTGCCATGGAATTCAGGGGGG + Intronic
1112364564 13:98745671-98745693 CAGAGCCTTCGGAGGGAGTGTGG + Intronic
1113705183 13:112425818-112425840 CAGTGCCATGGAGGGTGGGGAGG - Intronic
1113707807 13:112445630-112445652 GAGAGCCCGGGGAGGGAGGGCGG - Intergenic
1114182170 14:20376375-20376397 CAGCTCCATGGGAGGGATGCAGG + Intronic
1114866016 14:26597192-26597214 CCGGGCCGCGGGAGGGAGGGAGG + Intronic
1115046402 14:29000291-29000313 GACTGCCAGGGCAGGGAGGGAGG + Intergenic
1115369408 14:32595215-32595237 CAGTGACATGGGAGAGTGGCTGG - Intronic
1115511051 14:34138178-34138200 CAGGGGCATGGGAAGGAGAGTGG + Intronic
1115921811 14:38382653-38382675 CATTGCAATGGGTGTGAGGGTGG + Intergenic
1117174001 14:53129624-53129646 TAGAGACATGGGCGGGAGGGTGG - Intronic
1117186753 14:53247542-53247564 CAGGGCCAGGGGAGGGCAGGGGG - Intergenic
1117766948 14:59093205-59093227 AAGTGCAAAGGGATGGAGGGTGG - Intergenic
1117951097 14:61083236-61083258 CAGTGGCCTGGCAGGCAGGGAGG - Intronic
1118346602 14:64945740-64945762 CAGTGATGTGGGAGGGAGAGAGG - Intronic
1119473221 14:74911947-74911969 CAGTGGCAGGGCAGGGAGGGCGG + Intronic
1119505965 14:75173342-75173364 TGGTGCCACTGGAGGGAGGGAGG + Intronic
1119588943 14:75866847-75866869 CTGTGACATGGGAGTGAGAGAGG + Intronic
1119595417 14:75928548-75928570 CAATCTCAGGGGAGGGAGGGAGG - Intronic
1119877073 14:78069954-78069976 CAGAGCCTCGGGAGGCAGGGTGG + Intergenic
1121527784 14:94631710-94631732 CAGTGCCACGGGATGTAGCGTGG + Intergenic
1121894031 14:97628721-97628743 CAGCTACATGGGAGGGGGGGTGG - Intergenic
1122112408 14:99511653-99511675 GAGTGCCTTGGGAGGCAGTGGGG - Exonic
1122203132 14:100134570-100134592 AAGTGCAGTGGGAGGGAGAGAGG + Intronic
1122322040 14:100861086-100861108 TAGTGTGATGGGTGGGAGGGCGG + Intergenic
1122407177 14:101507519-101507541 CCGTGCCGCGGGAGGGAGGCAGG + Intergenic
1122580862 14:102770816-102770838 TAGTGGCAGGGGAGGGAGAGCGG - Intergenic
1122653988 14:103244701-103244723 CATTCCCATGGGGGGGGGGGGGG + Intergenic
1122986390 14:105213627-105213649 CAGTGCCAGGTGGGGGAGGGAGG - Intronic
1123062370 14:105600033-105600055 TGGAGCCCTGGGAGGGAGGGAGG + Intergenic
1123087113 14:105721761-105721783 CGGAGCCCTGGGAGGGAGGGAGG + Intergenic
1124017590 15:25890581-25890603 CAGTGCCAGGGGCGAGTGGGTGG + Intergenic
1124027626 15:25981647-25981669 AGGTGCAATGGGAGTGAGGGTGG + Intergenic
1124646922 15:31443824-31443846 CAATGGGACGGGAGGGAGGGAGG - Intergenic
1125927847 15:43577825-43577847 CAGTGCCATGAGAGAGATAGAGG - Intronic
1125940990 15:43677390-43677412 CAGTGCCATGAGAGAGATAGAGG - Intergenic
1127165615 15:56243291-56243313 CAGAGGGGTGGGAGGGAGGGAGG + Intergenic
1128532748 15:68465661-68465683 CCTTGCAATGGGAGGGAGTGTGG - Intergenic
1128544503 15:68558067-68558089 CAGTGGAATGGCAGGGAGGGTGG + Intergenic
1128749182 15:70136535-70136557 CAGTGACCTTGGAGGGAGAGGGG - Intergenic
1128797205 15:70474647-70474669 TAGTGACTTGAGAGGGAGGGAGG + Intergenic
1129139942 15:73588536-73588558 CAGTGGCATGGGATGGAGCTAGG - Intronic
1129318668 15:74761797-74761819 CAGTGCAATGGGGCGGAGGGGGG + Intergenic
1129359010 15:75012808-75012830 GAGTGCCATGGGATGGGGGTGGG + Intronic
1129888130 15:79052837-79052859 CAGGGCCACAGCAGGGAGGGTGG + Intronic
1130251702 15:82304228-82304250 CATTGCCCTGGGTGGGTGGGTGG + Intergenic
1130807816 15:87344989-87345011 CAGTGCCATGGGCTAGAGGAAGG - Intergenic
1131388867 15:92031005-92031027 CTGTACCCTGTGAGGGAGGGAGG + Intronic
1131419391 15:92291667-92291689 CAGGAACAAGGGAGGGAGGGAGG + Intergenic
1132244012 15:100280565-100280587 CAGGGCCTGGTGAGGGAGGGCGG - Intronic
1132293765 15:100720327-100720349 CAGTGCCAGGGTGGGGAGGGAGG + Intergenic
1132327554 15:100984491-100984513 AGGGGCCAGGGGAGGGAGGGAGG - Intronic
1132577815 16:672037-672059 CAGTGTTATGGTGGGGAGGGTGG - Intronic
1132610995 16:816314-816336 CAGTGCCAGGGGAGGGACACGGG - Intergenic
1132663444 16:1071481-1071503 CACTGCTGTGGGAGGGTGGGAGG + Intergenic
1132701217 16:1222911-1222933 CAGGGACCTGGGAGGGAAGGTGG + Exonic
1133219188 16:4311613-4311635 CAGCACAATGGCAGGGAGGGGGG + Intergenic
1134031781 16:10998034-10998056 CAATGGGATGGGAGGGAGGATGG - Intronic
1134150044 16:11797931-11797953 CTGCCCCATGGGATGGAGGGCGG + Intergenic
1134450253 16:14358908-14358930 CAGGGCCCTGGCAGGGAGTGAGG + Intergenic
1135083893 16:19459244-19459266 CAGGGCCATGTGAGGGAGGCAGG + Intronic
1136088537 16:27902548-27902570 CAGAGCAAGGGGAGGGAGAGGGG + Intronic
1136627590 16:31471761-31471783 GAATGGCATGGGTGGGAGGGAGG + Intronic
1136707443 16:32201637-32201659 CAGTGACCTGGGAGTGGGGGTGG + Intergenic
1136720567 16:32316595-32316617 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1136725629 16:32354987-32355009 CAGTACTTTGGGAGGGAGGTGGG + Intergenic
1136760468 16:32727780-32727802 CAGTGACCTGGGAGTGGGGGTGG - Intergenic
1136807635 16:33142606-33142628 CAGTGACCTGGGAGTGGGGGTGG + Intergenic
1136838947 16:33522877-33522899 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1136843959 16:33561049-33561071 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1136994370 16:35178507-35178529 AGCTGCCATTGGAGGGAGGGAGG - Intergenic
1137236819 16:46624180-46624202 CAGGGCTTAGGGAGGGAGGGAGG - Intergenic
1137315327 16:47314053-47314075 CATTTCTATAGGAGGGAGGGGGG + Intronic
1137466961 16:48718497-48718519 CAGTGCCCTGAGAGGGAGTCAGG - Intergenic
1137564025 16:49522124-49522146 CAGTGGCATGGGGATGAGGGAGG + Intronic
1137702261 16:50505870-50505892 CAGTGTCCTGGGAGGTTGGGGGG - Intergenic
1138266883 16:55665842-55665864 CAGTGGGATGGGAGGCAGTGTGG + Intronic
1138346069 16:56320990-56321012 CAGTCCCATGGGAGAGAGAGGGG + Intronic
1138350794 16:56345292-56345314 ATGTGCCATGGGAGGGAGGAGGG + Exonic
1138429936 16:56962218-56962240 GAGTGCCCTGGGAGGGAGATGGG + Intronic
1138885953 16:61079690-61079712 CAGAGCCATTGGAGGGAATGAGG + Intergenic
1139305666 16:65983854-65983876 CAATGCCCTGGGAGCGAGGTAGG - Intergenic
1139312845 16:66041880-66041902 CAGAGGCCTGGGAGGTAGGGGGG - Intergenic
1139546854 16:67653540-67653562 CAGCCCCGGGGGAGGGAGGGAGG - Intronic
1139647719 16:68343617-68343639 CAGTGCCATGGGAGCCTAGGAGG + Intronic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140225069 16:73070609-73070631 CAGTGCCTGCCGAGGGAGGGCGG - Intergenic
1140347862 16:74232391-74232413 CAGTGCTTTGGGAGGCAAGGTGG - Intergenic
1140407734 16:74722109-74722131 GAGTCCCTTGGGAGGGAGGGTGG - Intronic
1140760088 16:78102157-78102179 CAGTGCTTCGGGAGGGAGGCTGG - Intronic
1140910466 16:79446662-79446684 CAGTGCTTTGGGAGGCAAGGTGG + Intergenic
1141440877 16:84028944-84028966 GAATGTCATGGGAGGGAGGACGG - Intronic
1141635590 16:85312363-85312385 CCGAGCCTTGGAAGGGAGGGCGG - Intergenic
1141651575 16:85395798-85395820 CAGAGCCTGGGGAGGGTGGGCGG - Intergenic
1141651914 16:85397315-85397337 GAGTGCCAAGGGTGGGAGCGGGG - Intergenic
1141762611 16:86038676-86038698 CTGTGCCATGGGGAGGAGGAAGG + Intergenic
1141782579 16:86173714-86173736 CAGTCCCATTGAAGGGAGTGTGG + Intergenic
1142095819 16:88238910-88238932 CAAGGCCATGGGAGGGAGGGAGG - Intergenic
1142124271 16:88402424-88402446 GAGTGCAGTGGGAGGGAGGATGG + Intergenic
1142212881 16:88816715-88816737 CCGTGCCGTGGGAAGGAAGGTGG - Intronic
1142265542 16:89062572-89062594 CAGGGGCAGGGGAGGGAGTGAGG + Intergenic
1203000802 16_KI270728v1_random:162767-162789 CAGTACTTTGGGAGGGAGGTGGG - Intergenic
1203005865 16_KI270728v1_random:201175-201197 CAGTACTTTGGGAGGGAGGCGGG - Intergenic
1203062621 16_KI270728v1_random:988095-988117 CAGTGACCTGGGAGTGGGGGTGG - Intergenic
1203132404 16_KI270728v1_random:1699172-1699194 CAGTACTTTGGGAGGGAGGTGGG - Intergenic
1203149110 16_KI270728v1_random:1823164-1823186 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1203154124 16_KI270728v1_random:1861348-1861370 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1142687325 17:1585130-1585152 CACTGCCAAGGGGTGGAGGGAGG + Intronic
1142877893 17:2863281-2863303 CAGTGCCCTTGGAGCAAGGGTGG + Intronic
1143870557 17:9954876-9954898 CAGTCCCTTCGGAGAGAGGGAGG + Intronic
1143994680 17:10996490-10996512 GACTGCCATGGGAGTGAGTGGGG + Intergenic
1144329448 17:14211120-14211142 CAGTGGCAGTGGAGGGGGGGTGG - Intergenic
1144419555 17:15083797-15083819 CAGTGCTTTGGGAGAGACGGAGG - Intergenic
1144500890 17:15786315-15786337 CAGAGCCGGGGGAGGGACGGGGG + Intergenic
1144643832 17:16954979-16955001 CAGTTGCAGGGTAGGGAGGGAGG - Intronic
1144692484 17:17277243-17277265 CAGTCCCATGCGAGGCAGAGAGG - Intronic
1145163052 17:20588977-20588999 CAGAGCCGGGGGAGGGACGGGGG + Intergenic
1146162423 17:30567086-30567108 CAGAGGGATGGGATGGAGGGAGG - Intergenic
1146798509 17:35800036-35800058 CAGTGCAGAGAGAGGGAGGGAGG - Intronic
1146931748 17:36782794-36782816 CAGTCCCAAGGGAGAGGGGGAGG - Intergenic
1147177036 17:38662367-38662389 CAGTGCGTTAGGAGAGAGGGAGG - Intergenic
1147244860 17:39113242-39113264 CAGGGCCTTGAGAGGGAGCGTGG + Intronic
1147374436 17:40015550-40015572 CCCTGGCATGGGAGGGAGGCTGG + Intronic
1147598860 17:41733842-41733864 CAGTGCCAGGAGAGGGGCGGGGG - Intronic
1147652669 17:42071307-42071329 CAGCTCCAAGGGAGGGAGAGAGG + Intergenic
1147758576 17:42783500-42783522 CAGTGACAAGGCAGGGTGGGAGG - Intronic
1147999206 17:44377874-44377896 GTGTGCCAAGGTAGGGAGGGGGG + Intronic
1148540608 17:48477482-48477504 AGGAGCCGTGGGAGGGAGGGAGG - Intergenic
1148779025 17:50111421-50111443 CAGGGCCATGGGAGGTTGGAAGG - Exonic
1149512068 17:57250921-57250943 CAGGGCCCTGGGGGGGTGGGGGG - Intergenic
1149571987 17:57678578-57678600 CTCTTCCAGGGGAGGGAGGGAGG - Intronic
1149923222 17:60678046-60678068 CAGTGCAAGGGGCCGGAGGGCGG + Intronic
1150281549 17:63932058-63932080 CAGGGCCATGAGAGGGAGACAGG + Intronic
1150621547 17:66811714-66811736 GGGGGCTATGGGAGGGAGGGTGG - Intergenic
1151018192 17:70581512-70581534 CAGGGGCAAGGGAGAGAGGGAGG - Intergenic
1151032600 17:70758483-70758505 CAGAGCCATGGGTGGGATGTGGG + Intergenic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151677163 17:75604511-75604533 GAGGGGCATGGAAGGGAGGGAGG - Intergenic
1151696862 17:75722274-75722296 CTGAGCCATGGGAAAGAGGGCGG - Intronic
1151734613 17:75931312-75931334 CAGTGCCCTGGGATGCAGGTAGG - Intronic
1151756116 17:76076237-76076259 CGGTGCCGCGGGAGGGAGGGCGG - Intronic
1151850670 17:76687906-76687928 AAGTGCAATGGGGGTGAGGGAGG + Intronic
1151976018 17:77483897-77483919 AGCTGCCATGGGAGGGAGGAGGG - Intronic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152181857 17:78827210-78827232 CAAAGCCCTGGGAGGGTGGGTGG + Intronic
1152260634 17:79264953-79264975 CAGTGCGAGAGGAGGGGGGGGGG + Intronic
1152636461 17:81432551-81432573 CCCGGCGATGGGAGGGAGGGTGG - Intronic
1152681741 17:81671980-81672002 CAGCCCTATGGGAGGGAGGTGGG + Intronic
1153167084 18:2274250-2274272 CAGTGGCATTGGATGGATGGGGG + Intergenic
1153560860 18:6370571-6370593 CACTGCCCTGGGTGGGAGGGGGG - Intronic
1157451791 18:47794483-47794505 CAGTGCCCCTGGAGCGAGGGGGG + Intergenic
1157516995 18:48318277-48318299 CAGTCCTATGGGAGGAAGAGAGG - Intronic
1160160571 18:76466988-76467010 AAGGGCCCTGGGAGGCAGGGGGG + Intronic
1160429513 18:78801768-78801790 CATTGCCAAGGGAGGCTGGGAGG + Intergenic
1160528125 18:79549011-79549033 CAGTGGCATGGGTGTCAGGGAGG + Intergenic
1160586157 18:79914721-79914743 CAGTGCCAAGGGAGGAAGGTGGG + Intronic
1160888007 19:1360959-1360981 CAGAGGCGTGGGAGGGAGGCGGG - Exonic
1160888722 19:1365643-1365665 CAGTGCCAAGGGAGGGCGGAGGG - Intronic
1160894065 19:1394657-1394679 CAGTCCGCAGGGAGGGAGGGAGG - Intronic
1161065653 19:2236107-2236129 CAGTGCCAGGGGCGGGAGGCCGG - Intronic
1161106251 19:2445373-2445395 CTGTTCCCTGGGATGGAGGGAGG + Intronic
1161233449 19:3186804-3186826 CAGGGCCGTGGGAGGGGGTGGGG - Intronic
1162099790 19:8332989-8333011 CAGAGCCAAGGGAGGGTGGGTGG - Intronic
1162527046 19:11212155-11212177 CAGGGACAGGGGCGGGAGGGTGG + Intronic
1162743435 19:12786225-12786247 CAGGGACACGGGAGGGAGGCTGG + Intronic
1162821909 19:13228292-13228314 CAGTGCCAGGGAGGGGAGGAGGG + Intronic
1163012415 19:14433966-14433988 CAGTGCCCTGGGAGGGGAGGAGG + Intronic
1163288895 19:16365741-16365763 CAGTGCCACGGGAAGCAGAGTGG - Intronic
1163389509 19:17021888-17021910 CAGGGGCATGGGAGGGAGGGAGG - Intronic
1163527584 19:17830865-17830887 CAGAGCCGTGGGAGGGGGAGGGG + Intronic
1163681249 19:18683856-18683878 CAGGGCCGGCGGAGGGAGGGAGG + Intronic
1163686246 19:18713572-18713594 CAGTAACATTGGAGGGAGGAGGG - Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1163884236 19:19951683-19951705 CAGCGCTTTGGGAGGGAGGTGGG + Intergenic
1164411728 19:28011871-28011893 CAGAGCCTTGGGAGGGAGCATGG + Intergenic
1164730398 19:30499868-30499890 CAGGGGCAAGGGAGGGATGGTGG + Intronic
1164754562 19:30680003-30680025 CCAGGCCAGGGGAGGGAGGGAGG + Intronic
1164830201 19:31314300-31314322 CAGAGCCATGGGAGAGAGAGCGG + Intronic
1165094667 19:33403567-33403589 CTGTCCCATGGGAGGGAGCCAGG + Intronic
1165244875 19:34493127-34493149 CAGTGCCAGGGGTGGGAGGTGGG + Intronic
1165762492 19:38329823-38329845 CTGAGCCATGGAAGGGAGGAGGG + Intergenic
1165876406 19:39010637-39010659 CAATGCCATGGAAGAGACGGGGG - Intronic
1165924103 19:39316518-39316540 CAATGCCAGAGGCGGGAGGGGGG - Intergenic
1166496698 19:43307998-43308020 CAGCTCCATGGGAGGGAGGAAGG + Intergenic
1166695159 19:44847849-44847871 CATAGCAATGGGAGGGACGGGGG - Intronic
1166933268 19:46314903-46314925 CAGGGACATGGGAGTGTGGGAGG - Intronic
1167156317 19:47741434-47741456 CAGGGCCATGGGAGGGGGGCCGG - Exonic
1167423997 19:49420363-49420385 CAGAGCCAGGGCAGGGTGGGAGG + Intergenic
1167525800 19:49983132-49983154 GGGAGCCATGGGAGGGAGGGTGG - Intronic
1167530262 19:50011593-50011615 CAGGACCATGGGAGGGAGTTTGG - Intronic
1168126309 19:54285498-54285520 CACTGCCTTAGCAGGGAGGGAGG + Intergenic
1168175583 19:54625366-54625388 CACTGCCTTAGCAGGGAGGGAGG - Intronic
1168316842 19:55488342-55488364 CTGAGGCATGGGGGGGAGGGGGG - Intergenic
1168498911 19:56876987-56877009 CTGTGTCATGGGTGGGAGGGAGG - Intergenic
1168622826 19:57892732-57892754 CACTGCAATGGGAGTGGGGGGGG + Intronic
1168637967 19:58010792-58010814 GAGCGCCGTGGGAGGGAGGGAGG - Exonic
1168682726 19:58327528-58327550 CAGTGGCCTGGGAGGGTGTGGGG + Intronic
1202715065 1_KI270714v1_random:37869-37891 CTGTGCGGTGGGAGGGAGGGAGG - Intergenic
925086329 2:1110484-1110506 TATTTACATGGGAGGGAGGGAGG - Intronic
925313150 2:2902246-2902268 AACTGCCAAGGGAGGGAAGGAGG + Intergenic
925642988 2:6005318-6005340 CAGTGGGATGGGAGAGACGGTGG - Intergenic
925901579 2:8512974-8512996 CAGGGCAAGGGCAGGGAGGGTGG - Intergenic
925918548 2:8624186-8624208 CCGTGCCCAGGGAGGGAGTGGGG - Intergenic
926020128 2:9487282-9487304 CAGGGCAATGGGAGGGAGACTGG + Intronic
926144137 2:10386529-10386551 CAGGGCCCTGGGAGGGGGTGAGG + Intronic
927062203 2:19434161-19434183 CAGAGGCATGAGAGTGAGGGGGG - Intergenic
927114273 2:19886019-19886041 CAGTGCCATGGGGGTAGGGGAGG - Intergenic
927158518 2:20236326-20236348 CAGTGCCCTGGGATGGAGGCTGG + Intergenic
927484581 2:23479749-23479771 CATGGCTAAGGGAGGGAGGGAGG - Intronic
927557890 2:24049029-24049051 CAGAGCTGGGGGAGGGAGGGAGG - Intronic
927959604 2:27232885-27232907 CCCTGCCTTGGGAGGGAAGGAGG - Intronic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
928197636 2:29226890-29226912 CAGGGCCAGGGGAGGCAGAGGGG - Intronic
928260087 2:29758632-29758654 CAGTGCCTGGGGAGGGAGGAGGG - Intronic
928353203 2:30582208-30582230 CATTGCCATGGGAGGGGGGCAGG - Intronic
928431077 2:31218895-31218917 CAGACCCATGCGAGGAAGGGTGG - Intronic
928604859 2:32936270-32936292 CAGTGGCATGGGGGGTAGGGGGG - Intergenic
929642532 2:43596046-43596068 CAGGGCAAAGGGAGGGAGAGAGG + Intronic
930017956 2:46983848-46983870 CAGGTCCTTGGGAGGGAGGGAGG - Intronic
931385589 2:61795098-61795120 CAGATCCATGGGAGAGAGTGTGG - Intergenic
931567513 2:63629788-63629810 CAGTGCTACGGCAGGAAGGGTGG - Intronic
932304965 2:70695498-70695520 AAGTGCAGTGGGAGGGAGGAGGG - Intronic
932321357 2:70824097-70824119 CAGAGCCAGGAGAGGGAGAGAGG + Intergenic
932485896 2:72084095-72084117 CAAGGCCATGGGAGCAAGGGGGG + Intergenic
932571393 2:72940300-72940322 CATTGGCCTGGGACGGAGGGTGG + Intergenic
932987871 2:76748648-76748670 GAGCTCCATGGGGGGGAGGGAGG - Exonic
933083380 2:78023420-78023442 CAGCACCATGCAAGGGAGGGAGG + Intergenic
933632667 2:84674750-84674772 CAGTGCCATGGGGATGAGGGTGG + Intronic
934090923 2:88549894-88549916 AAGGGCCTTGGGATGGAGGGTGG - Intergenic
934320260 2:91965579-91965601 CAGTACCTTGGGAGGGAGGCGGG - Intergenic
934814371 2:97312523-97312545 CTGTGCCGTGTGAGGGAGGTAGG + Intergenic
934823322 2:97395960-97395982 CTGTGCCGTGTGAGGGAGGTAGG - Intergenic
935212617 2:100951658-100951680 GAGTGCCAGGGGCTGGAGGGAGG + Intronic
936034835 2:109102679-109102701 CAGAGCCTTGGGGGAGAGGGAGG + Intergenic
937140360 2:119595060-119595082 AAGTGACCTGGTAGGGAGGGAGG - Intronic
937321005 2:120960767-120960789 CAGTGCCCTGGGAGGAACGCAGG - Intronic
937340306 2:121086899-121086921 CAGAGTCATGGGAGGAAGAGGGG + Intergenic
937434386 2:121868088-121868110 CAGTGCCTGGGAAGGGATGGAGG - Intergenic
937875707 2:126823880-126823902 CAGTGCCATGGGCAGAAAGGAGG - Intergenic
937882371 2:126878063-126878085 CGGTGCCTAGGGAGGGCGGGAGG - Intergenic
938021674 2:127910905-127910927 CAGTGACATGAGAGGGACAGGGG - Intergenic
941304333 2:163843026-163843048 CAGTGCAATGGGGGAAAGGGTGG - Intergenic
941333392 2:164208965-164208987 CTGTGCCATGGCATGGAGGCAGG + Intergenic
941978582 2:171431744-171431766 CAGGGCCATGGGCGGGAGTGGGG + Intronic
942243879 2:173989813-173989835 CAGAGCACTGGGAGGGAGGGGGG - Intergenic
942405852 2:175653966-175653988 CAGTGGAAAGGGTGGGAGGGGGG + Intergenic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
943782149 2:191836648-191836670 CGGTGCCGTGGAAGGGAAGGAGG - Exonic
944433653 2:199663224-199663246 CAGCGACTTGGGAGGGAGGTGGG + Intergenic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
944512829 2:200481542-200481564 GCGTGCAAAGGGAGGGAGGGAGG - Exonic
945175477 2:207039218-207039240 CATTGTCAAGGGAGGGAGTGTGG + Intergenic
945918121 2:215726151-215726173 CAGGGAGAGGGGAGGGAGGGAGG + Intergenic
946050097 2:216855339-216855361 GAGTGCCGTGGGAGGGATTGGGG + Intergenic
946180671 2:217947158-217947180 CATTGGGGTGGGAGGGAGGGAGG - Intronic
946688927 2:222296608-222296630 CGGTGCCATGGGTGGGAGCCGGG + Intronic
946835092 2:223764415-223764437 CAGTGTCCTGGGAGGAATGGAGG + Intronic
947666686 2:231910438-231910460 CAGTGTCTTGGAAGGTAGGGTGG + Intergenic
947986284 2:234450364-234450386 CAGGGCAGTGGGAGGGAGAGTGG + Intergenic
948138097 2:235652334-235652356 CAGTGGCCTGGGGGGTAGGGGGG - Intronic
948330428 2:237160390-237160412 GAGTCCCAGGGGAGTGAGGGAGG + Intergenic
948457629 2:238114225-238114247 CAGAGCCATGGGGAGGAGGAAGG - Intronic
948549945 2:238764623-238764645 CAGAGCCAAGTGAAGGAGGGAGG + Intergenic
948650636 2:239441309-239441331 CAGAGCCTTGGGGGGCAGGGAGG - Intergenic
1168889042 20:1281944-1281966 CATTGCCATGGGGCAGAGGGTGG + Intronic
1169044454 20:2524760-2524782 AAGGGCCAAGGCAGGGAGGGCGG - Intergenic
1170418422 20:16168883-16168905 GAGTTTCATGGGAGGGAGTGGGG + Intergenic
1170605818 20:17874426-17874448 GAGTGCCAGGGGAGTGAGAGGGG - Intergenic
1170772411 20:19344591-19344613 CAGTGGCTTGGGAGGCGGGGAGG + Intronic
1171192248 20:23166839-23166861 CAGAGCCCTGGGAGGATGGGCGG + Intergenic
1172573224 20:35986590-35986612 CAGTGCCATGTCAGGGACGAAGG - Intronic
1172771279 20:37384069-37384091 CTGTGGAATGGGTGGGAGGGAGG + Intronic
1172773254 20:37393523-37393545 AGCTGCCTTGGGAGGGAGGGAGG - Intronic
1173119768 20:40277888-40277910 CAGAGCCAAGGGAGGTGGGGAGG + Intergenic
1173354055 20:42270366-42270388 CAGAGCCCTGGGCGGGTGGGAGG - Intronic
1173470818 20:43322019-43322041 CAGTGCCCTGAGAGGGAGGGTGG + Intergenic
1173987899 20:47276692-47276714 CAGTGCCATGCAAGAGATGGAGG - Exonic
1174651580 20:52130149-52130171 AAGTGCCATGGCAGGGTGGAGGG - Intronic
1175318715 20:58070484-58070506 CTGGGCCATGGGAGGGGGTGTGG - Intergenic
1175336621 20:58200276-58200298 CACTGCTCTGGGAAGGAGGGGGG + Intergenic
1175375837 20:58523355-58523377 TAGGGCCGGGGGAGGGAGGGAGG + Intergenic
1175388388 20:58611542-58611564 AGGTGCCAGGGGAGGGAGGTGGG + Intergenic
1175759090 20:61549305-61549327 GGGTGACATGGGAGGGAGTGAGG - Intronic
1175915706 20:62424777-62424799 GAGTGCCCTGGGAGAGTGGGTGG - Intronic
1175924983 20:62467131-62467153 GAGAGCCACGGGAAGGAGGGAGG - Intronic
1175962067 20:62642354-62642376 CTGTGCCCTGGGGGGGAGGAGGG + Exonic
1176041933 20:63070264-63070286 AATTGCTGTGGGAGGGAGGGTGG - Intergenic
1176200365 20:63857718-63857740 CATTGTCAGGGGAGGGAGTGGGG - Intergenic
1176966691 21:15219025-15219047 CAGTGCATTGGGGGGGTGGGTGG + Intergenic
1177563322 21:22785138-22785160 AAGTGCTATGGGAGGCAGGATGG + Intergenic
1179176735 21:39013353-39013375 CAGTGCACAGGGAGTGAGGGAGG + Intergenic
1179403334 21:41104596-41104618 CAGTGCCATTGCAGGAAGTGAGG - Intergenic
1179802819 21:43819490-43819512 CAGTCCCAGGGGAGAGAGGAGGG + Intergenic
1179922219 21:44513511-44513533 GAATTCCATTGGAGGGAGGGCGG - Intronic
1180042508 21:45287606-45287628 CAGGCCCACGGGATGGAGGGTGG - Intronic
1180232632 21:46436476-46436498 CAGTGCCAGCGGGGGGGGGGGGG - Intronic
1180308508 22:11149624-11149646 CAGTACTTTGGGAGGGAGGCGGG - Intergenic
1180546985 22:16511437-16511459 CAGTACTTTGGGAGGGAGGCGGG - Intergenic
1180726144 22:17948117-17948139 CAGTGGCAGGGATGGGAGGGAGG - Intronic
1180959623 22:19756737-19756759 CCGGGCCAGGTGAGGGAGGGAGG + Exonic
1180959684 22:19756943-19756965 CGGTGCCCTAGGCGGGAGGGAGG + Intronic
1181275693 22:21686431-21686453 CAGTGCCATGGGAGGCAGTTGGG - Intronic
1181533318 22:23529465-23529487 CAGTGCCAGGGAATGGCGGGGGG + Intergenic
1181688328 22:24544079-24544101 CTGTGCTGTGGGCGGGAGGGGGG + Exonic
1182092287 22:27604038-27604060 CAGTGCCAGCCCAGGGAGGGGGG - Intergenic
1182107461 22:27699529-27699551 CAGCCTCCTGGGAGGGAGGGCGG + Intergenic
1182475792 22:30575599-30575621 CACGGCGATGGGAGGGAGTGAGG - Intergenic
1182547684 22:31085308-31085330 CGGCGCCCTGCGAGGGAGGGCGG + Intronic
1182758241 22:32698873-32698895 CAGTGGCATGAGATGGAGGAGGG + Intronic
1183516944 22:38272440-38272462 CAGTGACCTGGGAGGGTGGTCGG - Intronic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1183604503 22:38860642-38860664 CAGTGCCATAGGGGTCAGGGAGG - Intergenic
1184088979 22:42282684-42282706 CAGAGACCTGGGAGGGAGGCCGG + Intronic
1184262804 22:43329090-43329112 CACTGGCATGGGAGGGAAGAAGG - Intronic
1184281367 22:43439480-43439502 CAGTGCCAGTGCAGGGAGGTGGG + Intronic
1184330302 22:43823048-43823070 CAGTTGCATGGGAGTGCGGGTGG - Intergenic
1184652600 22:45925968-45925990 CAGGGACAGGGGAGGGAGGAGGG - Intronic
1184687812 22:46104398-46104420 GAGAGGCCTGGGAGGGAGGGCGG + Intronic
1184739474 22:46419099-46419121 CAGTTCCATGGGAGGAAGCCAGG + Intronic
1185133245 22:49052434-49052456 CAGCACCACGGGAGGGAGGGCGG + Intergenic
1185149432 22:49155547-49155569 CAGTGGCATTGGAGGGGGTGAGG + Intergenic
1185288733 22:50013797-50013819 CGGTCCCAGGGGAGGGAAGGCGG + Intergenic
1185309416 22:50145907-50145929 CAGTGCTCAGGGAGGGAGGCAGG + Intronic
950406105 3:12805967-12805989 CAGTGCTATAGGAGGTAGGATGG + Intronic
950490575 3:13302236-13302258 CAAGGCCATAGGAGGGAGGATGG - Intergenic
950602973 3:14051560-14051582 CAGGGTGATGGAAGGGAGGGGGG - Intronic
950610837 3:14125590-14125612 CAGTCCCTTGGGAGGGAGGAAGG + Intronic
950696273 3:14703472-14703494 CAGTGATATTGTAGGGAGGGTGG - Intronic
950765833 3:15272351-15272373 CAGTGCCACAGCAGGAAGGGAGG + Intronic
952125115 3:30290953-30290975 GGGGGTCATGGGAGGGAGGGAGG - Intergenic
952187856 3:30989764-30989786 GAGAGACAGGGGAGGGAGGGAGG - Intergenic
952390150 3:32873084-32873106 CAGCACGCTGGGAGGGAGGGAGG - Intronic
952756163 3:36869621-36869643 CAGGGCCATGGGAATGAAGGAGG - Intronic
952827823 3:37538591-37538613 CAGGGCCCTGGGAAGGTGGGTGG - Intronic
953493766 3:43369673-43369695 CAGGGCCATGGTATGGAGGGGGG + Intronic
953616806 3:44497964-44497986 CAGTGTAATGGGAGGGAGACGGG + Intergenic
953888931 3:46736275-46736297 CAGGGGCATGGGACGGAGGCTGG - Intronic
954036310 3:47852942-47852964 CAGTGACATGGGAGGAGGGAAGG + Exonic
954130711 3:48559334-48559356 CAGGGCCATGGGAGGGGAGATGG - Intronic
954155678 3:48683773-48683795 CAGGGCCAGGGGAGGGCTGGGGG - Intronic
954155793 3:48684441-48684463 GAGTGCCAGGGGTGGGAGTGGGG - Intronic
954458054 3:50610717-50610739 TGGTGCCAAGTGAGGGAGGGTGG - Intronic
955487152 3:59446834-59446856 CAGGGAGATGGGAGGTAGGGAGG - Intergenic
956951350 3:74287084-74287106 CTCTGCCATAGGAAGGAGGGAGG - Intronic
960043920 3:113178195-113178217 CACTGGCATGAGTGGGAGGGAGG + Intergenic
960266374 3:115625102-115625124 CAGCGCCCTGGAAGGAAGGGTGG + Intronic
960935710 3:122900157-122900179 CAGGGCCATGGGAGGAAGAAGGG + Intergenic
961219348 3:125187505-125187527 CAGTGCTGTGGGAGGAGGGGAGG - Intronic
961241896 3:125418408-125418430 CAGTGCTATGGAAGGGAGAGAGG - Intergenic
961504755 3:127362706-127362728 CAGTCCTGTGGCAGGGAGGGAGG - Intergenic
961749938 3:129088877-129088899 CAGGGCTTAGGGAGGGAGGGAGG - Exonic
962015024 3:131430886-131430908 CACTGCCAGGGGATGGAGGAGGG - Intergenic
962248534 3:133819688-133819710 CAGTGCCAAGGGTGGAAGAGGGG + Exonic
962269228 3:133965959-133965981 GAGTGACATGGGAGAGAGGGAGG + Intronic
962628329 3:137249675-137249697 TAGTGCCATGGCAGAGAGGCTGG + Intergenic
962649890 3:137477822-137477844 CAGGGCAATGGGAGGGGAGGGGG + Intergenic
962686431 3:137852491-137852513 CAGTGCCAGGGAAGGGGCGGAGG - Intergenic
962747130 3:138405146-138405168 AAGTGCCATGAGAAGGAGGTGGG - Exonic
963038675 3:141052773-141052795 CAGGGCTCTGGGAAGGAGGGAGG + Intronic
967035515 3:185646002-185646024 GAGGGACAGGGGAGGGAGGGAGG + Intronic
967170297 3:186817971-186817993 CAGGGCCATGGGTGAGAGGAAGG + Intergenic
967350772 3:188511325-188511347 GAGGGACAAGGGAGGGAGGGAGG - Intronic
968038143 3:195565945-195565967 CACTGCCGGGGGAGGTAGGGGGG - Intergenic
968505721 4:970452-970474 CAGAGCCCTTAGAGGGAGGGTGG + Intronic
968817697 4:2830222-2830244 GAGTGCCAGGGGAGCGAGGTGGG - Intronic
968880427 4:3295976-3295998 CAGTGCCTCGGGAGGGAGCTTGG - Intronic
968939011 4:3628459-3628481 CAGCACCGTGGGAGGGAGGGAGG - Intergenic
968968895 4:3783394-3783416 CTGTGCCAGGGCTGGGAGGGAGG + Intergenic
969137773 4:5044428-5044450 CAGGGCAAAGGGAGGGAAGGAGG - Intergenic
969575939 4:8035742-8035764 CAGAGCCATGGCAGCGAGGGTGG + Intronic
969658022 4:8509217-8509239 GAGTGGGGTGGGAGGGAGGGAGG + Intergenic
969681231 4:8644594-8644616 CAGAGCCATGGGAGGGAGCCTGG - Intergenic
969684864 4:8665709-8665731 CTGTCCCCAGGGAGGGAGGGAGG + Intergenic
969724346 4:8910506-8910528 CAGTGGCAGGGGTGGGGGGGCGG + Intergenic
971267266 4:25106519-25106541 CCATGCGATGGGAGGGAGGATGG - Intergenic
971452388 4:26812159-26812181 CAGAGCCTTGGGAGGCAGCGAGG + Intergenic
971774598 4:30946471-30946493 CAGTGTGGTGGGAGGGAGGTGGG - Intronic
971947109 4:33294995-33295017 CAGTGAGCTGAGAGGGAGGGAGG - Intergenic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
972260908 4:37407554-37407576 CAGTGACGTGAGAGGGAGTGGGG + Intronic
972331432 4:38067849-38067871 CTGGGCCATGGGAGGTAAGGAGG - Intronic
972659740 4:41104627-41104649 CAGGGCCAAGGGTGGGAGGAGGG - Intronic
972693219 4:41419838-41419860 GAATGGCATGGGAGGGAGGGAGG - Intronic
974220352 4:58961361-58961383 CAGTGCTATGGGAGGGCTGGAGG - Intergenic
976492419 4:85687002-85687024 TATTGGCATGGGATGGAGGGGGG + Intronic
977635994 4:99299238-99299260 CAGTGATAAGGGTGGGAGGGAGG + Intergenic
978811544 4:112854866-112854888 GAGTAGAATGGGAGGGAGGGTGG + Intronic
980210063 4:129775357-129775379 CAGTGCCATGGCAGGTAGAGAGG + Intergenic
980649600 4:135695591-135695613 CAGTTCCACGGGAGGCATGGTGG + Intergenic
981027140 4:140088201-140088223 AAGTGTGATGGGAGGGAGGAAGG + Intronic
982783569 4:159516526-159516548 CAGTCTCATGGGAAGGAGGAAGG + Intergenic
984545686 4:181099616-181099638 AAGAGACAGGGGAGGGAGGGAGG + Intergenic
984582069 4:181521678-181521700 CAGTGCTGAGGGAGGAAGGGAGG - Intergenic
985159631 4:187031132-187031154 TTGTGGGATGGGAGGGAGGGGGG - Intergenic
985563291 5:602731-602753 CAGAGCCTCGGGAGGGAGTGGGG - Intergenic
985672789 5:1214813-1214835 CAGGGCCTGGGTAGGGAGGGTGG + Intronic
985766132 5:1780423-1780445 CACTGCCCAGGGAGGGTGGGAGG + Intergenic
986027315 5:3863308-3863330 CACAGCCATAGCAGGGAGGGAGG + Intergenic
986203929 5:5605363-5605385 CAGTGACATGTGTGGGAGAGGGG - Intergenic
986299343 5:6466062-6466084 CAGGGCCCTGGGAGGGTGGCAGG - Intronic
986616712 5:9624821-9624843 CCGATCCATGGGAGGGAGAGAGG + Intergenic
986811867 5:11368427-11368449 CAGTCCTATGGCAGGGAGGGAGG + Intronic
988204439 5:28115690-28115712 CAAGACCATGGGAGGCAGGGCGG - Intergenic
988529417 5:32014620-32014642 CAGGGCCATGGGTGGTATGGGGG - Intronic
988956475 5:36324746-36324768 CACTGCCAGGGGATGGAGGAGGG + Intergenic
989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG + Intronic
989251297 5:39319047-39319069 CTGTGCTATGGGAGGGTTGGGGG - Intronic
990316942 5:54591524-54591546 CAGAGCCATGCAAGGGAAGGTGG + Intergenic
990807658 5:59684171-59684193 CAGTGCTCAGGGAGGGATGGAGG - Intronic
990946153 5:61252023-61252045 CAATGCAATGCAAGGGAGGGTGG - Intergenic
992023410 5:72647646-72647668 CAGTGAGATGAGGGGGAGGGAGG + Intergenic
992077173 5:73202233-73202255 CAGGGCGGAGGGAGGGAGGGAGG + Intergenic
992877218 5:81068827-81068849 CTGAGGCCTGGGAGGGAGGGAGG - Intronic
993026914 5:82657648-82657670 AAGGGCCATGGGAGGGAGGTTGG - Intergenic
993094999 5:83471518-83471540 GAGTGCCTGGGGAGGGAGGCAGG + Exonic
993526670 5:88973694-88973716 AGGTGGGATGGGAGGGAGGGAGG + Intergenic
994539950 5:101081904-101081926 AAGGGAGATGGGAGGGAGGGAGG - Intergenic
997715090 5:136036623-136036645 CAGTGCCATGGGTGGTCAGGTGG + Intronic
997726607 5:136125984-136126006 CAGGGCCATGGGAGGAAGTTGGG + Intergenic
997860447 5:137410846-137410868 CAATGCACTGGGAGGGAGGAGGG + Intronic
998045061 5:138980425-138980447 GAGTCCCATGGCAGGGAAGGAGG + Intronic
998164830 5:139837020-139837042 GAGGGGCATGGGAGGGAGGCTGG + Intronic
999197445 5:149792075-149792097 GAGTGGCCTGGGAGGGAAGGTGG + Intronic
999479235 5:151930367-151930389 CAGTGTCATTGGAAGGAAGGAGG + Intergenic
999732799 5:154487877-154487899 TAGTGCCCTGTGAGGCAGGGTGG - Intergenic
1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG + Intronic
1000082524 5:157861428-157861450 CAGGCCCAGGGGAGGGAAGGTGG - Intergenic
1000176070 5:158755729-158755751 CAATGCCCTTGGAGGGAGAGGGG + Intronic
1000343358 5:160294593-160294615 CAGAGCCATGGGTTGGATGGGGG - Intronic
1000371340 5:160539578-160539600 CATTGCCATAGTAGGGTGGGAGG + Intergenic
1000793169 5:165631867-165631889 CAGTGCCATGGGCTGGGGAGAGG - Intergenic
1000943931 5:167397198-167397220 CAAAACCATGGAAGGGAGGGAGG + Intronic
1001027185 5:168234066-168234088 CCCTGCCATGGGATGGAAGGGGG - Intronic
1001027307 5:168235010-168235032 CAGTGACAGAGGAGGGAGGTGGG + Intronic
1001270993 5:170311614-170311636 CACTCCCCTGGGAGGGAGGCGGG + Intergenic
1001489666 5:172146498-172146520 CAGTGCTGTGGGAAGGAGTGTGG - Intronic
1001517164 5:172364046-172364068 CTGTGCCATGGGATTCAGGGTGG + Intronic
1001761893 5:174214364-174214386 CAGCTCCCTGGGAGGGAGAGAGG - Intronic
1001854119 5:174995866-174995888 CACTGTCACAGGAGGGAGGGAGG + Intergenic
1001930098 5:175666676-175666698 CAGTGCTTTGGGAGGCAAGGCGG - Intronic
1001932273 5:175681677-175681699 TAGTGCAAAGGGAGGAAGGGAGG + Intronic
1002454776 5:179339719-179339741 CAGTGCCAAGGTGGGGTGGGAGG + Intronic
1002495316 5:179607673-179607695 CAGGGCACTGGGAGGGTGGGTGG - Intronic
1003093933 6:3127424-3127446 AAGGGCCAGGGGAGGAAGGGTGG + Intronic
1003186863 6:3839742-3839764 CTGGGGTATGGGAGGGAGGGAGG - Intergenic
1004157516 6:13183432-13183454 CAGTCACGTGGGAGGGTGGGAGG + Intronic
1004806761 6:19211261-19211283 CAAAGCCATGGCAGGGAGAGGGG + Intergenic
1005251787 6:23955076-23955098 CAGTGCCCTGGGAGAGAGAGAGG + Intergenic
1005693972 6:28334661-28334683 CAATGGGATGGGAGGAAGGGAGG + Intronic
1006181294 6:32154821-32154843 CTGTGGCAGGGGAGGGAGAGCGG + Intronic
1006275864 6:33005244-33005266 CAGTACTTTGGGAGGGAAGGTGG + Exonic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1006670326 6:35726306-35726328 CAGTGCCCAGGGACTGAGGGTGG + Intronic
1006732725 6:36248171-36248193 CAATGCTGTGGGAGGAAGGGAGG + Intronic
1007221545 6:40282826-40282848 CACTACCATGTAAGGGAGGGTGG - Intergenic
1007966787 6:46010691-46010713 AAGTGCCATGGCAGGGTGGTGGG - Intronic
1008055053 6:46937284-46937306 CAGTGACATGGGAGAAAGAGGGG - Intronic
1008192138 6:48473145-48473167 GATTGACATGGGAGGGTGGGAGG - Intergenic
1008336753 6:50315549-50315571 CAGTACCAGGGGAGGGAGAGAGG + Intergenic
1008957671 6:57233654-57233676 CCCTGTCAAGGGAGGGAGGGAGG - Intergenic
1009375389 6:62961773-62961795 CACTGCCAGGGGATGGAGGAGGG + Intergenic
1010097598 6:72064479-72064501 CTGTCCTCTGGGAGGGAGGGAGG + Intronic
1010180065 6:73076102-73076124 CAGTGCTTTGAGAGAGAGGGGGG - Intronic
1010993263 6:82503962-82503984 CAGGGATATGGTAGGGAGGGAGG - Intergenic
1012496923 6:99843941-99843963 AATTGCCATGGGAAGAAGGGAGG - Intergenic
1013078403 6:106791073-106791095 CAGTGACATGGGGGATAGGGTGG - Intergenic
1013099335 6:106974366-106974388 CAGGGCCGTGGGAGGAGGGGGGG + Intronic
1013342864 6:109232303-109232325 CAGAGACATGGGACTGAGGGAGG + Intergenic
1013467403 6:110429884-110429906 CAGTGGCATGGAAGGGGAGGAGG + Intronic
1013635344 6:112023995-112024017 CACTGCCCCGGGAGGGAGCGTGG + Intergenic
1014150027 6:118044084-118044106 CAGTGCCTTGGGATGGAGGGTGG + Intronic
1014488295 6:122028959-122028981 GTGTGCCATGGGAAGGAGAGAGG + Intergenic
1015875748 6:137820320-137820342 CAGAGCCAGGGGAGTGAGTGGGG + Intergenic
1016054856 6:139567581-139567603 CACTGCCAGGGGATGGAGGAAGG + Intergenic
1016980271 6:149847268-149847290 CAGTGCCTGGGCAGGCAGGGGGG - Intronic
1017408989 6:154149379-154149401 ACGTGTCATGGGAGGGATGGAGG - Intronic
1017914750 6:158822952-158822974 CAGTGCCTTGGAAGGAAGTGAGG + Intergenic
1017959201 6:159207119-159207141 AAATGCCATGGAAGGGAGGCAGG + Intronic
1018199459 6:161381679-161381701 CAGCTTCATGGTAGGGAGGGAGG + Intronic
1018671256 6:166179425-166179447 AGGTGCCATGGGTGGGATGGGGG - Intergenic
1018722909 6:166587265-166587287 CACTGGCATGGGACAGAGGGAGG + Intronic
1018830590 6:167439861-167439883 CAGAGCCTTTGGAGGGAGTGAGG + Intergenic
1018906401 6:168078724-168078746 CAGAGCCATGGGGGTGAGGAGGG - Intronic
1018919785 6:168163610-168163632 CAGTGCCCTCGGCGGGAGGCAGG + Intergenic
1019278885 7:190542-190564 CAGTGGCGGGGCAGGGAGGGGGG + Intergenic
1019413957 7:919037-919059 CAGTGCCATGGGGGCCTGGGAGG - Intronic
1019465593 7:1186393-1186415 AAATGCCAGGGGAGGGATGGAGG - Intergenic
1019558195 7:1642794-1642816 CCGTAGCATGGGAGGGAGGGAGG - Intergenic
1019587278 7:1812489-1812511 AGGTGCAGTGGGAGGGAGGGAGG + Intergenic
1019723284 7:2586590-2586612 CAATGCTGTGGGAGGGAGAGAGG + Intronic
1020091571 7:5345062-5345084 CTGTGCCATGGGAGAACGGGTGG - Intronic
1020210726 7:6156244-6156266 CAGGCACATGGGAGGGAAGGAGG + Intronic
1021444595 7:20718603-20718625 CAGAGCCCTGGGGGGGAGGGAGG + Intronic
1021486338 7:21172577-21172599 GAGAGACAGGGGAGGGAGGGAGG - Intergenic
1021501758 7:21339501-21339523 CAGGGCAATGGGAGGGATGGGGG - Intergenic
1022372287 7:29783253-29783275 CAGTGATATGGGAGGGAGACAGG + Intergenic
1023873523 7:44275134-44275156 CTGAGCCAGGGAAGGGAGGGAGG - Intronic
1024204698 7:47147245-47147267 CAGGGCCCTGGCGGGGAGGGGGG + Intergenic
1025055576 7:55762057-55762079 CAGGGCATTGGGAGGGTGGGAGG - Intergenic
1025078472 7:55963324-55963346 CAGTCCCAGGGGAAGAAGGGAGG - Intronic
1025910386 7:65824094-65824116 CAGGGCATTGGGAGGGTGGGAGG + Intergenic
1028920337 7:96303727-96303749 CACTGACATGGGAGGGCAGGAGG - Intronic
1029211876 7:98916030-98916052 CAGGGCCAGGGGAGGGGGGCAGG - Intronic
1029611164 7:101627345-101627367 CAGGGGCAGGGGTGGGAGGGAGG + Intronic
1029611947 7:101631130-101631152 TAGTGCCATTGGAAGGAGGTGGG + Intergenic
1029813889 7:103074895-103074917 CGCTGCCAGGGGCGGGAGGGAGG + Exonic
1031995777 7:128229906-128229928 CACTGGCAGGGGAGGGAAGGAGG + Intergenic
1032198638 7:129804269-129804291 CAGTGCCAGGGGAGGCAGCTGGG + Intergenic
1032456102 7:132074704-132074726 CAGTGGCATGACAGGGAGGCCGG + Intergenic
1032854924 7:135826039-135826061 CAGTGGTATGGGAGGGAGAGAGG - Intergenic
1033137741 7:138798709-138798731 CAGTGCCCGGGGAGGCAGGAGGG - Intronic
1033425379 7:141239288-141239310 GAGTGCCATGGGAGAGAGGGAGG + Intronic
1033641063 7:143263611-143263633 CAGTGTCTGGGGAGTGAGGGCGG + Intronic
1033740891 7:144274972-144274994 AAGTGGCATGGGGAGGAGGGTGG - Intergenic
1033753015 7:144374641-144374663 AAGTGGCATGGGGAGGAGGGTGG + Intronic
1034057278 7:148048487-148048509 CAGTCCAATGGCAGGGAGGCTGG + Intronic
1034517241 7:151590517-151590539 CACTGCCATGGGAGGCTCGGAGG - Intronic
1034974822 7:155441937-155441959 CAGAGCCCTGGGAGGGGGGAGGG - Intergenic
1035194164 7:157201470-157201492 CAGCCACAGGGGAGGGAGGGCGG + Intronic
1035347796 7:158217141-158217163 AAGTGCCCTGGCAGGGTGGGTGG - Intronic
1035460283 7:159034402-159034424 CAGTTCCCAGGGAAGGAGGGAGG - Intronic
1037723714 8:21466348-21466370 CAGTGTAATGGGGGGAAGGGTGG + Intergenic
1038050268 8:23802572-23802594 CAGTTGCATGGGAGGGAGTATGG - Intergenic
1038407623 8:27333851-27333873 GAGGGCTAAGGGAGGGAGGGAGG - Intronic
1038425679 8:27462437-27462459 CAATGCCATGGCAGGGGCGGGGG + Intronic
1038459162 8:27702166-27702188 CAATGACATGGGAGAGAGGCTGG - Intergenic
1038670403 8:29578399-29578421 GATTGCCAAGGGAGGGAGTGTGG - Intergenic
1039518317 8:38151143-38151165 CAGGGCCAGGCGAGGGATGGAGG + Exonic
1039617751 8:38969791-38969813 CAGTGCCATGGGAGGGAGGGAGG + Exonic
1039990231 8:42481503-42481525 GAGAGACATGGGAAGGAGGGAGG + Intronic
1040067886 8:43163111-43163133 CAGTGAGGTGGGAGGGAGGTTGG + Intronic
1040091434 8:43402584-43402606 CAGTGGCAAGAGAGTGAGGGGGG + Intergenic
1041636864 8:60154853-60154875 GAGTGACAGGGTAGGGAGGGGGG - Intergenic
1042055021 8:64755328-64755350 CAGTGCTATGGGAGAGACTGAGG - Intronic
1042120620 8:65484068-65484090 CAGTTGGATGGGAGGGATGGAGG + Intergenic
1042292084 8:67179343-67179365 CAGTGTCATGGGAGAGAGAGGGG - Intronic
1043573540 8:81631091-81631113 CAGTGCTTTGGGAGGCAGAGGGG + Intergenic
1044236697 8:89839552-89839574 CAGAGACATGGGTGGGAGTGAGG - Intergenic
1044624523 8:94223772-94223794 CAGTGGCCTGGGAGTGAGGGGGG + Intergenic
1046057474 8:109095972-109095994 GAGTGCCATGGGAGCCAGAGAGG - Intronic
1046868265 8:119174907-119174929 CACTGGGATGGGAGGCAGGGTGG + Intronic
1047116877 8:121852775-121852797 TACTGCCATGGGAGGGCTGGTGG - Intergenic
1047150239 8:122252677-122252699 CATTGCCAGGTGATGGAGGGTGG + Intergenic
1047408565 8:124605594-124605616 CAGCGCGAGGGCAGGGAGGGAGG - Intronic
1047408572 8:124605617-124605639 CAGCGCGAGGGCAGGGAGGGAGG - Intronic
1048038545 8:130701810-130701832 CAGTGCCATGGGAACAAGGTAGG + Intergenic
1048202141 8:132383360-132383382 CAGGGCCAGGGCAGCGAGGGAGG + Intronic
1048528970 8:135230060-135230082 CAGTGTCAGGGAAGGGAGGAAGG + Intergenic
1048681005 8:136842041-136842063 CACAGCCAGGGGAGGGAGAGGGG - Intergenic
1048899217 8:139021964-139021986 CAGGGCCAGGAGAGGGAGAGGGG + Intergenic
1049053924 8:140220173-140220195 CAGCGCCAGGGGAGGGTGGTGGG + Intronic
1049070145 8:140349599-140349621 CAGTGGGGTGGGAGAGAGGGAGG + Intronic
1049351335 8:142166357-142166379 CAGTGCCCTGGCAGGCAGTGGGG + Intergenic
1049377504 8:142296161-142296183 CACTACCATGGGAGAGGGGGTGG + Intronic
1049408743 8:142463185-142463207 CAGGGCCTGGGGAGGGATGGAGG - Intronic
1049420227 8:142513178-142513200 CAGAGCCACGGGACCGAGGGCGG + Intronic
1049431942 8:142569361-142569383 GAGGACCATGGGAGGGAAGGGGG - Intergenic
1049585987 8:143432598-143432620 CAGTGCGATGGGCGGGAGGGGGG - Intergenic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1052744191 9:32423749-32423771 CAGGGCAAAGGGTGGGAGGGAGG + Intronic
1053066969 9:35075723-35075745 CAGGGCCCTGGAGGGGAGGGGGG + Exonic
1053218545 9:36292822-36292844 CAATGCCATGAAAGGGAGGGAGG - Intronic
1053551063 9:39079876-39079898 CGGTGGTGTGGGAGGGAGGGTGG - Intronic
1053815173 9:41899957-41899979 CGGTGGTGTGGGAGGGAGGGTGG - Intronic
1054451735 9:65406861-65406883 CAGCACCGTGGGAGGGAGGGAGG + Intergenic
1054615423 9:67287484-67287506 CGGTGGTGTGGGAGGGAGGGTGG + Intergenic
1055062045 9:72079046-72079068 CAGTGGGAAGGGTGGGAGGGAGG + Intergenic
1055656281 9:78453057-78453079 CAGTGCCAGGGCAGGGCAGGGGG + Intergenic
1056474934 9:86945142-86945164 CAGTGACGTGGGGGTGAGGGTGG - Exonic
1057519705 9:95751534-95751556 CTGAGCTGTGGGAGGGAGGGAGG + Intergenic
1057597038 9:96423471-96423493 CAGTGCTTTGGGAGGCTGGGGGG - Intergenic
1058472389 9:105293622-105293644 CAGTGATATGGCAGGCAGGGTGG - Intronic
1058485747 9:105442045-105442067 CAGAGCCATGGGAGGGTAGATGG + Intergenic
1059456361 9:114402610-114402632 CAGTGGGCTGGGATGGAGGGGGG + Exonic
1060135588 9:121150339-121150361 CAGTGCCAGGGGTGAGAGGTCGG - Exonic
1060439859 9:123628313-123628335 CAGTGACATGGGAGGGAGGAAGG + Intronic
1060586082 9:124786909-124786931 CAGTGCTATGGCAGGGAGGAAGG - Intronic
1060870953 9:127039768-127039790 CAGTGAAATGGGAGGGAAAGGGG + Intronic
1061034730 9:128107197-128107219 CAGTCCCCTGGGAGGTCGGGGGG + Intronic
1061420995 9:130472765-130472787 CAGCTCCAAGGGAGGCAGGGAGG + Intronic
1061537564 9:131259312-131259334 CAGTGACCTGGGACCGAGGGAGG + Exonic
1061680516 9:132240658-132240680 CAGTGCCAGGGCGGGGAAGGTGG + Intronic
1061718067 9:132533443-132533465 TAGAGCCCTGGGAGGGAGCGGGG - Intronic
1061816730 9:133201824-133201846 CTGTCCCATGAGAGGGATGGGGG + Intergenic
1061970480 9:134042128-134042150 AATTGCCTGGGGAGGGAGGGTGG - Intronic
1062213173 9:135375430-135375452 CAGAGCCTTCGGTGGGAGGGTGG + Intergenic
1062254869 9:135616116-135616138 AAGGGGCATGGGAGTGAGGGGGG + Intergenic
1062542384 9:137047358-137047380 CAGTGCCCTGGCGAGGAGGGTGG - Intergenic
1062617171 9:137403148-137403170 CACTGCCATGGAGGGGAGAGGGG - Intronic
1062636068 9:137492534-137492556 CGGGGCCATGGGCGGGTGGGTGG + Intronic
1062669685 9:137700659-137700681 GAATGCTATGGTAGGGAGGGTGG - Intronic
1185595713 X:1305548-1305570 CAGTGACCTGGGATGGAAGGTGG + Intronic
1186581472 X:10824466-10824488 CAGTGCAATAGAAGGAAGGGAGG - Intronic
1186650521 X:11555365-11555387 AAGGGACATGGGAGGGAGAGAGG + Intronic
1186766192 X:12773006-12773028 CAGCTCCTTGGGAGGGAAGGGGG + Intergenic
1187500225 X:19833187-19833209 GAGGGCCCTGGGAAGGAGGGAGG - Intronic
1187818769 X:23262412-23262434 AGGAGCCATGGGAGAGAGGGTGG + Intergenic
1187975956 X:24705691-24705713 CAGGGGCAGGGGAGGGGGGGAGG - Intronic
1188393776 X:29655285-29655307 CAATGCTGTGGGAGGGAGGTGGG - Intronic
1190233964 X:48602000-48602022 CTGTGCCCTGGGAGGGCTGGAGG - Intronic
1192433130 X:71125934-71125956 GAAGGCTATGGGAGGGAGGGAGG - Intronic
1193968477 X:88020106-88020128 AAGTGGCAGGGGTGGGAGGGTGG + Intergenic
1194482957 X:94449632-94449654 CAGTTCTATGGGATAGAGGGAGG - Intergenic
1196107265 X:111910392-111910414 CAGGGCTGTGGGAGAGAGGGAGG + Intronic
1196797631 X:119515070-119515092 CAGTGCATTGGGAGGCAGAGCGG + Intergenic
1196816170 X:119667043-119667065 CTGTTCCATGGGAGGGAGTTGGG - Intronic
1196869053 X:120095934-120095956 CAATGACAGGGGAGGGAGGCAGG + Intergenic
1197460780 X:126737937-126737959 CAGCTCCAGGAGAGGGAGGGAGG - Intergenic
1197708188 X:129648683-129648705 CAGGGCCCTGGCAGGGAGGTCGG - Exonic
1197750557 X:129961059-129961081 CAGTGCCAAGGCAGAGAGGAAGG + Intergenic
1197835658 X:130691061-130691083 GAGAGCCATGGGTGGGAGGGAGG - Intronic
1198434257 X:136599972-136599994 CATTGCCATGGGAGGAAGAGTGG - Intergenic
1198831886 X:140759605-140759627 CAGTGACTTGGGAGGGAGGCAGG - Intergenic
1198975074 X:142327393-142327415 CATTGCCATGGGAGCATGGGTGG - Intergenic
1199852453 X:151735449-151735471 AAGTGAAATGGGAGGGATGGGGG - Intergenic
1200276416 X:154737272-154737294 CAGAGCCCTGGGAGGAAAGGCGG + Intronic
1200370106 X:155715928-155715950 CACTGCCAGGGGATGGAGGAGGG + Intergenic
1201942810 Y:19477942-19477964 ATGTACCATGGGAGGGAGTGGGG + Intergenic
1202097061 Y:21262996-21263018 CAGTGTTGTGGGAGGCAGGGAGG + Intergenic