ID: 1039618153

View in Genome Browser
Species Human (GRCh38)
Location 8:38973625-38973647
Sequence TATGAAGGACTGGCTGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039618153_1039618156 9 Left 1039618153 8:38973625-38973647 CCTGCGGCAGCCAGTCCTTCATA 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1039618156 8:38973657-38973679 GTTCAGATAAAGCAAACGTTTGG 0: 1
1: 0
2: 0
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039618153 Original CRISPR TATGAAGGACTGGCTGCCGC AGG (reversed) Exonic
911603642 1:99875388-99875410 TATGAACGACTGGCTGGCCATGG + Exonic
917264031 1:173200714-173200736 GATGAAGGTCTGGCTGCCGCTGG + Intronic
921163470 1:212489137-212489159 GATGAAGGAGTGGCTGGCTCAGG - Intergenic
923325403 1:232876025-232876047 TATGAAGGAATGTCTGAAGCTGG - Intergenic
924423159 1:243928222-243928244 TAAGAAGAGCTGGCTGGCGCTGG - Intergenic
1063116217 10:3073749-3073771 TATGAAGGACTGACTCCCCGAGG - Intronic
1067243607 10:44517485-44517507 TTTGAAGGAGTGGCTGCCGGAGG - Intergenic
1068591474 10:58857109-58857131 TCTGAAGGACGGGCTGCCGTGGG - Intergenic
1076073142 10:127508926-127508948 TATCAATGACTGGCTGCCTCTGG + Intergenic
1076838528 10:133033234-133033256 TATAAAGGACTGCCTGAGGCTGG - Intergenic
1078475053 11:11622490-11622512 AAGGAAGGAGTGGATGCCGCTGG - Intergenic
1086808498 11:91273664-91273686 TATGAAGGAATGCCTGAGGCTGG - Intergenic
1092039023 12:5367145-5367167 TGGGAAGGACTGGCTGACCCAGG + Intergenic
1097992890 12:65854915-65854937 TATAAAGGTCTGGCTGGCCCTGG + Intronic
1100550398 12:95641583-95641605 TCTGAAGGCCTGTCTGCCTCAGG + Intergenic
1106317666 13:28609230-28609252 TGTCTAGGACTGGCTGCAGCAGG + Intergenic
1114610660 14:24037890-24037912 GATGAAGGACTGGGAGCGGCTGG + Intergenic
1120693891 14:87622545-87622567 TATAAAGGACTGGCTGAGACTGG + Intergenic
1122500709 14:102197361-102197383 TACCAAGGGCTAGCTGCCGCAGG + Intronic
1123023404 14:105412501-105412523 TGTGAGGAGCTGGCTGCCGCAGG + Exonic
1123441488 15:20295128-20295150 TATGGAGCAGTGGCCGCCGCCGG + Intergenic
1126859455 15:52870086-52870108 TCTGGAGGACTGTCTGCAGCTGG - Intergenic
1128154473 15:65384139-65384161 CAGGAAGCACTGGCTGCCTCTGG + Exonic
1129156125 15:73719312-73719334 GATGAAGGATGGGGTGCCGCTGG + Intergenic
1129417049 15:75390116-75390138 TTTGAAGGACTGGCTTCCCTAGG - Intronic
1131772481 15:95753824-95753846 TATGAATGAATGACTGCCTCAGG + Intergenic
1136775370 16:32868878-32868900 TGTGAAGGCCTGGCTGGGGCAGG + Intergenic
1136895246 16:33992634-33992656 TGTGAAGGCCTGGCTGGGGCAGG - Intergenic
1140698307 16:77557212-77557234 CTTGAAGGAATGGCTGCAGCTGG - Intergenic
1142309444 16:89303745-89303767 TATGATTGTGTGGCTGCCGCAGG - Intronic
1203077787 16_KI270728v1_random:1130987-1131009 TGTGAAGGCCTGGCTGGGGCAGG + Intergenic
1149589380 17:57817227-57817249 GATCAAGGACTGGCTGAGGCAGG + Intergenic
1152775415 17:82198525-82198547 TATGAAGGGGTGGCTTCAGCAGG + Intronic
1157086903 18:44589765-44589787 TAAGTTGGACTGGCTGCCGCAGG - Intergenic
1159101540 18:63964144-63964166 TTTGAAGGTGTGGCTGCCACAGG - Intronic
1159262037 18:66026571-66026593 TATGAAGGAATGCCTGAGGCTGG - Intergenic
1159662763 18:71119072-71119094 AATGAATGAGTGGCTGCCGAAGG - Intergenic
1160982210 19:1821630-1821652 GTTGGAGGACTGGCTGCCGCTGG + Exonic
1161283455 19:3457571-3457593 GATGTAGGAGTGGCTGCCACAGG + Intronic
1162122082 19:8476994-8477016 TAACAAGGACTGGCTGCCAATGG - Intronic
1162524266 19:11198028-11198050 AATGCAGGTCTGGCTGGCGCCGG - Intergenic
1163354797 19:16803296-16803318 TATGAAGGACTACCTGAGGCTGG - Intronic
1166291725 19:41867921-41867943 TATGAAGGGCTGGCTGTATCTGG + Intronic
1167721140 19:51181481-51181503 TCTGAGGAACTGGCTGGCGCGGG + Intergenic
925031358 2:652234-652256 TGGGAAGGACGGGCTGCAGCCGG - Intergenic
925167526 2:1727275-1727297 TCTGAAGGAGGGGCAGCCGCTGG - Intronic
926113246 2:10195772-10195794 TGTGTAGGACTGGTTGCCACAGG + Intronic
926676274 2:15624396-15624418 TATGAAGAACTGCCTGAGGCTGG + Intronic
927677825 2:25119481-25119503 TATGAAGGCCAGGCAGCCGAAGG + Intronic
932405580 2:71510993-71511015 TTTGAGAGACTGGCTGCCCCAGG + Intronic
932845749 2:75134405-75134427 TCTGAAGGAGTGGCTGTCTCTGG + Intronic
933847963 2:86340593-86340615 TATGAAGCATTGGCTGCTGTGGG + Intergenic
941527076 2:166619069-166619091 TATCAATGACTGGCTCCCTCTGG + Intergenic
946767804 2:223056197-223056219 TATGAAGAAGAGGCTGCCGCAGG - Intronic
948684448 2:239661391-239661413 GATGAAGGAGTGGCTCACGCTGG - Intergenic
1170679799 20:18516146-18516168 TAAGAAGGAGTGGCTGGCCCAGG - Intronic
1174729653 20:52903308-52903330 TATGAAGAACTGTCTGGCACTGG + Intergenic
1180954992 22:19737564-19737586 AGTGAAGGACTGGCTGCCACTGG - Intergenic
1181493688 22:23276101-23276123 TAAGAAGGGCTGGGTGCGGCTGG + Intronic
1183261957 22:36800870-36800892 TAAGAAGCACTGACTGCCCCTGG - Exonic
1183322703 22:37174900-37174922 TATGAAGAACTGCCTGAGGCTGG + Intronic
1184403846 22:44288887-44288909 TTTGTAGGACTGTCTGCCCCTGG + Intronic
951522310 3:23621219-23621241 TATGGAGGACTGGCCGCCCAAGG + Intergenic
957317943 3:78592380-78592402 TATGAAGGAATACCTGACGCTGG - Intergenic
958823963 3:99007701-99007723 TAGGAAGGACTGGCTGGGTCAGG + Intergenic
965363443 3:167768791-167768813 TATCCAGCACTGGCTGCTGCAGG + Intronic
969637209 4:8376387-8376409 TATGGGGGACTGACTGCTGCAGG + Intronic
971639393 4:29111342-29111364 TAGGAAGGAATGGCTGCCCTTGG - Intergenic
975173662 4:71262011-71262033 TATAAATGACTGTCTGCCACAGG + Intronic
979301067 4:119088066-119088088 TGTAAAGGACTGGGTGCCCCTGG - Intergenic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
988216640 5:28283432-28283454 AATGCAGGACTGGCTACAGCTGG - Intergenic
988490442 5:31700986-31701008 GCTGAAGGACAGGCTGCCTCTGG + Intronic
993091432 5:83431425-83431447 TATGAAGAGCTGGCTGCCATGGG - Intergenic
996514180 5:124351202-124351224 TATAAAGAACTGCCTGACGCTGG - Intergenic
998510624 5:142711225-142711247 TATGAAGGACTGCCTGAGACTGG + Intergenic
1001700507 5:173703355-173703377 CCTGAAGGACTGTCTGCCACGGG + Intergenic
1008629109 6:53347585-53347607 TATGAAGCACTTCCTGCCACGGG + Intronic
1012506145 6:99948495-99948517 TCTGAAGGCTTGGCTGCGGCTGG - Intronic
1013314398 6:108927209-108927231 GAGGAAGGAGTGGCTGCCCCTGG + Intronic
1017190964 6:151652216-151652238 TATGAAGGAATGCCTGAGGCTGG + Intergenic
1020535250 7:9388859-9388881 TATGAAGGACTGTCTGAGACTGG - Intergenic
1029098882 7:98111508-98111530 TGTGAAGCCTTGGCTGCCGCTGG + Intronic
1032650546 7:133873419-133873441 CATGCTGGACTGGCTGCCCCAGG - Intronic
1033468962 7:141626108-141626130 TGTGAAGGATTGGCTTTCGCAGG + Intronic
1039618153 8:38973625-38973647 TATGAAGGACTGGCTGCCGCAGG - Exonic
1041072182 8:54135817-54135839 TATTAAGAACTGGGTGCGGCCGG - Intronic
1041830720 8:62150039-62150061 TCTGGAAGACTGGCTGCAGCTGG + Intergenic
1047509262 8:125503976-125503998 GAGGAAGGACTTGCTGCCTCTGG + Intergenic
1047578297 8:126182921-126182943 TGTGAAGGAATTGCTGCCACAGG + Intergenic
1049783493 8:144439596-144439618 CATGAGGGACTGGCTGGAGCGGG - Intronic
1056378342 9:86035566-86035588 TCAGAGGGACAGGCTGCCGCAGG - Exonic
1057821291 9:98333083-98333105 TGTGAAGGGCTGGCTTCCGTGGG + Intronic
1061936312 9:133859360-133859382 GATCAAGGACTGTCTGCGGCAGG + Intronic
1199602268 X:149548668-149548690 CCTGAAGGACTGGGTGCCACTGG + Intronic
1199648119 X:149930807-149930829 CCTGAAGGACTGGGTGCCACTGG - Intronic
1200104546 X:153705179-153705201 TGTGAAGGCCTGGCTGGGGCAGG - Intronic
1200123920 X:153804354-153804376 CATGAAGGCCTGGCTGCTGGAGG - Exonic