ID: 1039618749

View in Genome Browser
Species Human (GRCh38)
Location 8:38977478-38977500
Sequence CTGAGTCAGCACATCTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039618749_1039618751 4 Left 1039618749 8:38977478-38977500 CCCAGATAGATGTGCTGACTCAG 0: 1
1: 0
2: 1
3: 9
4: 108
Right 1039618751 8:38977505-38977527 TGCATTAACATAACATCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039618749 Original CRISPR CTGAGTCAGCACATCTATCT GGG (reversed) Intronic
901184934 1:7366856-7366878 CTGATACAGCTCATCTGTCTGGG + Intronic
903994138 1:27294788-27294810 CTGAGCTAGGACATCTCTCTGGG - Intronic
905008472 1:34730193-34730215 CTGTGTATGCACATCTATTTGGG - Intronic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
905246763 1:36620325-36620347 CCGAGTCAGCACTTCTTTCAAGG - Intergenic
917837250 1:178951159-178951181 CTGAGTCAGCAGATTTGTTTGGG - Intergenic
924102241 1:240616847-240616869 ATGAGTCACCACATCTGGCTTGG - Intergenic
1063087723 10:2834615-2834637 CTGAGTCAACTCGTCTATCCCGG - Intergenic
1065811856 10:29450196-29450218 CTGCGCTAGCACTTCTATCTTGG - Intergenic
1067841264 10:49681183-49681205 CTGATTCAGCACCTCTGTCTAGG - Intronic
1071853555 10:89600213-89600235 CTGTGTAAGCACCTCTTTCTTGG - Intronic
1072633040 10:97159902-97159924 CAAAGTCAGCAAACCTATCTTGG - Intronic
1074125287 10:110524390-110524412 CTGAGTCAGCAGCTCTAACAGGG - Intergenic
1075861446 10:125680206-125680228 CTGAGTCAACACTTCCCTCTCGG + Intronic
1084720057 11:70899727-70899749 CTGAGCCAGCACAACCATCAGGG - Intronic
1088749756 11:112833826-112833848 CTGAGTCAATACATCTGTGTTGG + Intergenic
1089260707 11:117222081-117222103 CTGAGTCGGGAGATCTCTCTGGG - Intronic
1089777360 11:120847775-120847797 CTGAGTTAGCACCTTTAGCTTGG + Intronic
1091767428 12:3130688-3130710 CTGACTCTGCACATCTCTGTGGG - Intronic
1092480990 12:8858825-8858847 CTGTGTCACCAAATCCATCTGGG + Intronic
1097047426 12:56197621-56197643 CTGACTAAACACATCTATGTGGG + Intergenic
1097831967 12:64234661-64234683 ATGAGTCAAAACATCTGTCTTGG - Intergenic
1099713406 12:86259297-86259319 ATCAGTCTGCACATGTATCTGGG + Intronic
1102338636 12:112104085-112104107 CTGAGTTAGGACATTTCTCTTGG - Intronic
1106385569 13:29282234-29282256 CAGAGGCAGCACTTCTCTCTGGG - Intronic
1107055882 13:36102991-36103013 ATGAGTCTGCACATTTATGTGGG - Intronic
1107958176 13:45537776-45537798 ATGGCCCAGCACATCTATCTTGG - Intronic
1108055952 13:46485319-46485341 CTGAATCAGCTCAGCTAGCTAGG + Intergenic
1114529294 14:23385831-23385853 CTAAGTGAGCACATCTAGCCAGG - Intronic
1115939863 14:38596701-38596723 GTGAGTCACCACATCTGTCCAGG - Intergenic
1121673297 14:95730349-95730371 CCGAGTCATCACATCCATCCAGG - Intergenic
1122865307 14:104601261-104601283 CTGAGTCTGCACAGGTATCGGGG + Intronic
1122903053 14:104789821-104789843 CTGGGTCTGCACATCTAACAGGG - Intronic
1127034298 15:54897921-54897943 GTGTGTCAGCACATATATCTAGG - Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1133308451 16:4826816-4826838 CTGGGGCAGCACAGCTGTCTTGG + Intronic
1133616323 16:7480022-7480044 CTGAGTCAGCACATGGACATCGG - Intronic
1135862240 16:26067274-26067296 CTGATTCAGAACTTCTCTCTAGG - Intronic
1140294006 16:73690251-73690273 CTGAGTCTGCAAATCTAGTTTGG - Intergenic
1142264046 16:89055446-89055468 CTGACTCAGCCCATCTGTCGGGG - Intergenic
1147128459 17:38390493-38390515 TTGAGTCAGTACATCAATTTGGG + Intronic
1149854727 17:60071252-60071274 CTGAGTCAAGAAATCAATCTTGG - Intronic
1150179074 17:63095652-63095674 CTGAGTCAGCTGATCTAGGTTGG - Intronic
1151769001 17:76147451-76147473 CAGAGTCAGGACAGCTCTCTGGG - Intronic
1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG + Intergenic
1156260923 18:35444482-35444504 CTGTGTCTGCACATCAACCTTGG - Intronic
1159363748 18:67438657-67438679 CTGTGTGAGGACATCTAACTTGG - Intergenic
1162307358 19:9883311-9883333 CTGACTCAGCCCATCCCTCTGGG + Intronic
1162502951 19:11064936-11064958 CTGAGTCAGCACCTCTGCCCGGG + Intronic
1163377525 19:16942631-16942653 CTGAGTCAGCAGAGGTTTCTTGG - Intronic
1166713086 19:44949439-44949461 CTGAGTCAGCCCCTCCATCTTGG - Exonic
1168256043 19:55165930-55165952 CAGAAGCAGCACATCTAGCTCGG + Exonic
927271988 2:21221179-21221201 CAGAGGCAGCACAGCTATGTGGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
933996285 2:87672354-87672376 CTGAGTCTGAGCATCCATCTAGG + Intergenic
937226805 2:120374980-120375002 TTGAGACAGCCCATCTCTCTTGG - Intergenic
938109121 2:128552479-128552501 CTGAATCAGCACCTCTATACTGG + Intergenic
938964857 2:136379409-136379431 CTGACTCAGCAGGTCTAGCTGGG - Intergenic
941499905 2:166261273-166261295 CTGAGGCAGGACATTTATCTGGG - Intronic
944176970 2:196841291-196841313 TTGGGTCAGCACATTTATATAGG - Exonic
947083110 2:226420757-226420779 CTGAATCAGCAAATCTTTCAAGG - Intergenic
948321670 2:237074749-237074771 CTGAGTCAGGACATATGTCGTGG - Intergenic
1169301342 20:4444241-4444263 CTGTTTCAGCCCATCTCTCTGGG - Intergenic
1177115128 21:17075848-17075870 TTGAGTCAGCAAATCTATCTAGG + Intergenic
1178807367 21:35850907-35850929 CTGAGTCTGCAAATATTTCTGGG - Intronic
951093562 3:18602042-18602064 CTTACTCAGCACATCTTCCTAGG + Intergenic
953076340 3:39573954-39573976 CTGAGTGAGAACTTCTATCCCGG - Intergenic
953707129 3:45239781-45239803 CTGATTCAGCACATCTGGGTGGG + Intergenic
954615091 3:51965455-51965477 CTGAGTGATCACATCTGACTTGG - Intronic
962667532 3:137670135-137670157 CTCAGTCAACACTTCTCTCTTGG - Intergenic
969129020 4:4977360-4977382 CTATGACAGCACATCTATCAGGG - Intergenic
971395571 4:26224132-26224154 CTGACACAGAACATCTATCTTGG + Intronic
973055967 4:45657959-45657981 ATGAATCATCACATCTATATTGG + Intergenic
974365131 4:60937187-60937209 CTTAGTCATCAGATCTATTTGGG - Intergenic
976000952 4:80372444-80372466 CTTAGCCAGCACTGCTATCTGGG - Intronic
976811566 4:89105642-89105664 TTGAGCCAGAGCATCTATCTGGG - Intronic
978488030 4:109278175-109278197 CTGAATCAGCATATCTATTCAGG + Intronic
980639579 4:135559019-135559041 CAGGTTTAGCACATCTATCTTGG + Intergenic
981603433 4:146518003-146518025 CTGGGTCACCACATATCTCTAGG - Intronic
981613103 4:146617772-146617794 CTGGGCCAGCAGGTCTATCTGGG + Intergenic
985748117 5:1659290-1659312 CTGAGTCAGCACAGCCTGCTTGG - Intergenic
985864102 5:2498657-2498679 CAGGGTCAGCACTTGTATCTGGG - Intergenic
986037630 5:3955495-3955517 CTCATTCTGCACATTTATCTCGG + Intergenic
990905900 5:60802592-60802614 TTGAATCAGCACATATATCCAGG + Intronic
991510854 5:67375185-67375207 CTCAGCCAGCACAACTATCTGGG + Intergenic
998975483 5:147641614-147641636 CTGATTCATCACATCTTTGTAGG + Intronic
1003017642 6:2480954-2480976 CTCATTCAGCTCATCTAACTAGG + Intergenic
1004374143 6:15077052-15077074 CTGAGTCAGAACATCTAGGATGG - Intergenic
1005285942 6:24326952-24326974 CAAAGTGAGCCCATCTATCTGGG - Intronic
1008467575 6:51847774-51847796 CTGAGGCAACTCACCTATCTGGG - Exonic
1010244405 6:73650010-73650032 CTTTGTCATCACATCCATCTCGG - Intronic
1018655249 6:166027789-166027811 TTGAGTATCCACATCTATCTGGG - Intergenic
1020601561 7:10280733-10280755 CTGAGTCTACAAATCTATATTGG - Intergenic
1024573046 7:50740396-50740418 ATTAGTCAGCAGATCTTTCTTGG - Intronic
1024688787 7:51777315-51777337 CAGAGCCAGCACTTCTAGCTAGG + Intergenic
1024890816 7:54200735-54200757 CTGACTCAACACATCTGTATTGG - Intergenic
1026346358 7:69477616-69477638 CTGAGTCAGGACTTGAATCTGGG + Intergenic
1026913435 7:74106072-74106094 CTGAATCAGCAGGTCAATCTGGG - Exonic
1027573086 7:79896335-79896357 CTTATTCAGCACCTCTAGCTGGG - Intergenic
1030042866 7:105467725-105467747 CTGAGTAAGCACCTCTCTCTGGG - Intronic
1033404317 7:141057228-141057250 GTGAGACAGCATATTTATCTTGG + Intergenic
1035916804 8:3634046-3634068 CTGACTCAGCACATCTGGGTAGG + Intronic
1037729821 8:21515024-21515046 CTCAGTCAGCATTTTTATCTGGG - Intergenic
1038321420 8:26530909-26530931 CTGAGCCACCACACCTAACTGGG - Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1039827965 8:41190920-41190942 ATGAGTCCCCACATCTTTCTTGG - Intergenic
1040397879 8:47016684-47016706 CAGAGTGAGGACATCTTTCTTGG + Intergenic
1042192785 8:66204818-66204840 GTGAGACAGAACAGCTATCTTGG + Intergenic
1043773776 8:84238760-84238782 AGGAGTCAGCACATCCATGTGGG + Intronic
1044052677 8:87527757-87527779 CTGAGTGTGTACACCTATCTGGG - Intronic
1049563301 8:143324264-143324286 CTGGGGCAGCAAATCTAGCTGGG + Intronic
1053477676 9:38393720-38393742 CTGAGTCAGCAGATCTGCCAGGG - Intronic
1054969251 9:71065965-71065987 CTGAACCAGCACAGCCATCTGGG + Intronic
1056019096 9:82423066-82423088 CTGAGTTTGCAAATCTATCTTGG + Intergenic
1059625844 9:116065152-116065174 CAGAGGCAGGACAGCTATCTGGG + Intergenic
1186305660 X:8254620-8254642 CTGAGTCAGTAGTTTTATCTCGG - Intergenic
1196608312 X:117681346-117681368 ATGTGATAGCACATCTATCTGGG + Intergenic
1197700107 X:129593284-129593306 CTGAGTCAGCACATTCATCAGGG - Intergenic
1199395262 X:147330124-147330146 CTGATTCAGTAAATCTAGCTTGG + Intergenic