ID: 1039618751

View in Genome Browser
Species Human (GRCh38)
Location 8:38977505-38977527
Sequence TGCATTAACATAACATCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039618749_1039618751 4 Left 1039618749 8:38977478-38977500 CCCAGATAGATGTGCTGACTCAG 0: 1
1: 0
2: 1
3: 9
4: 108
Right 1039618751 8:38977505-38977527 TGCATTAACATAACATCCCTAGG No data
1039618750_1039618751 3 Left 1039618750 8:38977479-38977501 CCAGATAGATGTGCTGACTCAGA 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1039618751 8:38977505-38977527 TGCATTAACATAACATCCCTAGG No data
1039618748_1039618751 10 Left 1039618748 8:38977472-38977494 CCTTTACCCAGATAGATGTGCTG 0: 1
1: 0
2: 1
3: 7
4: 142
Right 1039618751 8:38977505-38977527 TGCATTAACATAACATCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039618751 Original CRISPR TGCATTAACATAACATCCCT AGG Intronic
No off target data available for this crispr