ID: 1039618761

View in Genome Browser
Species Human (GRCh38)
Location 8:38977606-38977628
Sequence TGTTAAGCTTTGAGCTGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039618759_1039618761 7 Left 1039618759 8:38977576-38977598 CCTTTCTGTTTGTGGCTTATTCA 0: 1
1: 0
2: 6
3: 82
4: 1321
Right 1039618761 8:38977606-38977628 TGTTAAGCTTTGAGCTGGAATGG No data
1039618757_1039618761 19 Left 1039618757 8:38977564-38977586 CCTGGGTGATCTCCTTTCTGTTT 0: 1
1: 0
2: 2
3: 33
4: 341
Right 1039618761 8:38977606-38977628 TGTTAAGCTTTGAGCTGGAATGG No data
1039618756_1039618761 20 Left 1039618756 8:38977563-38977585 CCCTGGGTGATCTCCTTTCTGTT 0: 1
1: 1
2: 0
3: 23
4: 294
Right 1039618761 8:38977606-38977628 TGTTAAGCTTTGAGCTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039618761 Original CRISPR TGTTAAGCTTTGAGCTGGAA TGG Intronic
No off target data available for this crispr