ID: 1039619735

View in Genome Browser
Species Human (GRCh38)
Location 8:38985553-38985575
Sequence CAGTGCCCTCTGATTTCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039619735_1039619736 -3 Left 1039619735 8:38985553-38985575 CCTAGTGAAATCAGAGGGCACTG 0: 1
1: 0
2: 0
3: 13
4: 170
Right 1039619736 8:38985573-38985595 CTGTTCAGCACAGCAGTCATAGG No data
1039619735_1039619738 28 Left 1039619735 8:38985553-38985575 CCTAGTGAAATCAGAGGGCACTG 0: 1
1: 0
2: 0
3: 13
4: 170
Right 1039619738 8:38985604-38985626 TACTAAATTTGGCTTGTCCCTGG No data
1039619735_1039619737 17 Left 1039619735 8:38985553-38985575 CCTAGTGAAATCAGAGGGCACTG 0: 1
1: 0
2: 0
3: 13
4: 170
Right 1039619737 8:38985593-38985615 AGGTCTCATGTTACTAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039619735 Original CRISPR CAGTGCCCTCTGATTTCACT AGG (reversed) Intronic
900520337 1:3102299-3102321 CTGTCCCCTCTGGTTTCCCTGGG + Intronic
900997546 1:6130548-6130570 CAGTGCCCTCCCACTGCACTAGG - Intronic
901176194 1:7301378-7301400 CAGAGCCATCTATTTTCACTTGG - Intronic
901374784 1:8830076-8830098 CAGTCCCCTCTGATTACTCATGG + Intergenic
902627177 1:17683432-17683454 CACTGCCCCCTGCTCTCACTTGG + Intronic
903172780 1:21564036-21564058 CAATGCCCACAGATTTCCCTGGG - Exonic
903560638 1:24224602-24224624 CAGGCCCCGCTGAATTCACTGGG - Intergenic
903660171 1:24972272-24972294 CAGAGCCCTCTGAGCTCACTCGG + Intergenic
906772781 1:48500173-48500195 CATTGCTCTGTGATTTCTCTAGG + Intergenic
907884966 1:58584624-58584646 CAGTGACTTTTAATTTCACTGGG + Intergenic
908689994 1:66768414-66768436 CAGTGCCCTTTTATTTCCATAGG - Intronic
909638722 1:77848007-77848029 CTGTGCCCTCTTTCTTCACTAGG - Intronic
910711514 1:90187009-90187031 CTGTGCATTGTGATTTCACTGGG + Intergenic
917394774 1:174581518-174581540 CAATGGCCTCTGCTTTCAGTAGG + Intronic
918057266 1:181032844-181032866 AAGGCCCCTCTGATTACACTGGG + Intergenic
919023339 1:192136467-192136489 CAGTACCCTCTGAGTTGATTAGG + Intergenic
919518497 1:198556959-198556981 CTGTGCCCTTTGTTTTCACATGG - Intergenic
920180029 1:204126955-204126977 CTGTGCCCTCTGGATTCTCTGGG + Exonic
922741825 1:228018448-228018470 CAGTGAGCTCTGATTACACCAGG - Intronic
1068438416 10:57019905-57019927 CAGTGGCCTCTGCTAGCACTTGG - Intergenic
1068710837 10:60132058-60132080 CACTGCCATCTCATTTCAATTGG + Intronic
1073574108 10:104607404-104607426 CATCTCTCTCTGATTTCACTTGG + Intergenic
1073712980 10:106066495-106066517 AACTCCCCTCTGACTTCACTGGG - Intergenic
1074477744 10:113788079-113788101 CATTGTCCTCTGATTTTTCTTGG - Intergenic
1075482630 10:122795894-122795916 CCCTGTCCTCTGATGTCACTCGG - Intergenic
1076061233 10:127415938-127415960 CAGTGCCTTTTGTTTTCACCTGG + Intronic
1078288420 11:9982234-9982256 CAGTGTCCTCTGCTTTGGCTTGG - Intronic
1081857075 11:46310718-46310740 CTGTGACCTCTGACTTCACAGGG - Intronic
1083317716 11:61827006-61827028 TAGGGCCCTCAGATTTCAATGGG - Intronic
1085703782 11:78768220-78768242 CAGGGCCCTCTCAGTTCAGTGGG - Intronic
1090155937 11:124438943-124438965 CCTTGCCCTCTGGTTTCAGTTGG - Intergenic
1090229715 11:125092792-125092814 CGGAGCCCTTTGATTCCACTGGG - Intergenic
1094270144 12:28605147-28605169 CAGGGTCCTCTCATTTAACTTGG - Intergenic
1097430794 12:59503517-59503539 CAGTGCCCCTTGACTTCTCTTGG - Intergenic
1097971137 12:65634209-65634231 CAGTGCCCAGTGCTTTTACTGGG - Intergenic
1098199641 12:68041037-68041059 CACTGCTGCCTGATTTCACTGGG - Intergenic
1099233294 12:80052398-80052420 CAGTGGTCTCTCATCTCACTGGG + Intergenic
1099935868 12:89124643-89124665 TAGTGCTCTCTGATTTTCCTTGG + Intergenic
1100000885 12:89833747-89833769 AAGAGCCCTCTGATATTACTGGG - Intergenic
1100916288 12:99427222-99427244 CAGTGGCTTCTAATTGCACTTGG + Intronic
1101211462 12:102539091-102539113 GAGTTCCCTCTGCTTTTACTTGG - Intergenic
1104657674 12:130585720-130585742 CAGTGCCCACTGAATTTCCTGGG - Intronic
1105628353 13:22136270-22136292 CACTGTCCTCTGGTTTCCCTGGG + Intergenic
1106193753 13:27476140-27476162 CAGTGTCCTCTCATTCCTCTGGG + Intergenic
1110611340 13:77491494-77491516 ATGAGCTCTCTGATTTCACTGGG + Intergenic
1111872595 13:93851829-93851851 CAGTGACCTAGAATTTCACTAGG - Intronic
1111919781 13:94397868-94397890 CAGTTCCCTCTCATGACACTTGG - Intronic
1113382200 13:109814089-109814111 CAGAGCCCTCTGATTTGAAGGGG + Intergenic
1118892885 14:69924503-69924525 CAGTGCCCTCTTATGGCACCCGG + Intronic
1119855399 14:77896622-77896644 CAGTGCCCTCAGATGGCCCTTGG - Intronic
1120850746 14:89167072-89167094 CAGAGCCACCTGATTTTACTGGG + Intronic
1122387797 14:101360902-101360924 CAGTGCCTTCCGATCTCCCTGGG + Intergenic
1122780718 14:104142347-104142369 CTGTGCCCTCTGCTCTCACCAGG + Intronic
1122888662 14:104722882-104722904 CAGTCCCCTCTTCTTCCACTGGG - Intergenic
1123838383 15:24220895-24220917 CTGTGCCCTCTGACTACACTGGG - Intergenic
1123847922 15:24323175-24323197 CTGTGCCCTCTGACTACACTGGG - Intergenic
1123866969 15:24530541-24530563 CTGTGCCCTCTGACTACATTGGG - Intergenic
1123873651 15:24601388-24601410 CTGTGCCCTCTGACTGTACTGGG - Intergenic
1124187282 15:27541797-27541819 CAGTGCGCCCTCATTTCACTAGG - Exonic
1124791659 15:32732718-32732740 CACTGTCCTCTGATTAAACTTGG + Exonic
1126329920 15:47521197-47521219 CAGTGCTCTCTGATGGCACCTGG + Intronic
1130607563 15:85331570-85331592 AACTGTCCTCTGACTTCACTAGG + Intergenic
1130943732 15:88534518-88534540 CAGTACCTTCTGGTTCCACTGGG - Intronic
1131110219 15:89760269-89760291 CTGGGCCCTCTGACTTCTCTGGG - Intergenic
1131297832 15:91167610-91167632 AAGGGCCCTGTGATTACACTTGG + Intronic
1132349460 15:101130413-101130435 CAGTCCTTTCTTATTTCACTCGG - Intergenic
1134350165 16:13430064-13430086 CTTTTCCCTCTGATTTCACATGG - Intergenic
1136239336 16:28934578-28934600 TGGTGCCCTCTGCTTACACTGGG - Intronic
1140574793 16:76154582-76154604 TAGTGCCCACTGATTCCACAGGG - Intergenic
1145014689 17:19388510-19388532 CAGTGAGCTATGATTGCACTTGG - Intergenic
1146120043 17:30184871-30184893 CTGTGCCCTCTTTCTTCACTAGG - Exonic
1147404610 17:40201959-40201981 CAGTGCCCTTTGAATCCACTAGG + Intergenic
1147910766 17:43854583-43854605 TAGTGCCCTCTGATCTCCTTGGG + Intronic
1149941951 17:60879685-60879707 CATTGGCCTCTGTTTTTACTTGG + Intronic
1150163323 17:62917534-62917556 CTGTGCCCGCTGATTTGAATGGG - Intergenic
1151575367 17:74950372-74950394 CAGAGCCCACTGTTTGCACTGGG - Intergenic
1152382944 17:79951662-79951684 CAGTGGCCTCTGATTATACTTGG - Intronic
1153544429 18:6191679-6191701 CAGTGCACACTGATATGACTCGG + Intronic
1153962288 18:10149941-10149963 CAGTGGCCTCAGATGACACTGGG - Intergenic
1154129808 18:11727127-11727149 CTGTGCCCTCTGCTCTCACTGGG + Intronic
1156782824 18:40871448-40871470 CAGCTTCCTCTTATTTCACTTGG + Intergenic
1157438263 18:47689621-47689643 CACAGCCCTCTGATTTTCCTGGG - Intergenic
1157976693 18:52335995-52336017 AAGGCCCCTGTGATTTCACTGGG + Intergenic
1158397270 18:57089069-57089091 CAGTGCACTCTGAGTTCCCCAGG - Intergenic
1165578330 19:36840496-36840518 CAGTGCCCTATGTTTTTATTGGG + Intronic
925436262 2:3840461-3840483 CAGTGCCCTGTAATTTCAGAAGG + Intronic
926311864 2:11681108-11681130 CAGTGCTCTCTGAGTCCACTGGG - Intronic
930162167 2:48169557-48169579 CAGTGCCCTATTACTTAACTTGG + Intergenic
931126937 2:59288705-59288727 CAGTGCCCTCTGGGAACACTGGG + Intergenic
935057456 2:99580039-99580061 CAGTGGCCTCTGCTTGCTCTTGG + Intronic
936281117 2:111140878-111140900 CAGTTCCTTCTCTTTTCACTTGG + Intronic
936821770 2:116530396-116530418 CAGTGGCCTGTGACTTCTCTGGG - Intergenic
937696851 2:124818011-124818033 CACTGCCCCGTGTTTTCACTTGG + Intronic
942500929 2:176590338-176590360 CTGTGCCCTTTGATTACACTGGG + Intergenic
943446607 2:187994743-187994765 AACTGCCCTCTGATGCCACTGGG + Intergenic
943930639 2:193847446-193847468 CAGTGCCCAAGGATTTTACTGGG + Intergenic
946725394 2:222656681-222656703 CAGTGCTCTCTGCTGTCAGTGGG + Intergenic
946977263 2:225167000-225167022 GAGTGCCCTCTGAATCCTCTTGG + Intergenic
948102776 2:235388705-235388727 TAGTGCCCTCTAATTTTTCTGGG + Intergenic
948197114 2:236104325-236104347 CAGTGCCCTCTGACTGCACGGGG + Intronic
948324335 2:237100706-237100728 CACTTCCCTTTGATTTGACTAGG - Intergenic
948418735 2:237838901-237838923 CAGTGCCCAAGGATTTTACTGGG + Intronic
948510319 2:238459543-238459565 CTGGGCTCTCTGATTTCAATGGG - Intergenic
1170171076 20:13413236-13413258 CAGTGCCCTGTGCTTTCCCTAGG + Intronic
1172123102 20:32609954-32609976 CAATGCCCTCTCCCTTCACTGGG + Intergenic
1172569473 20:35958033-35958055 CAGTGCCTTTTGATGGCACTTGG + Intronic
1172838186 20:37886407-37886429 CAGTGCCCTCAGCCCTCACTGGG + Intergenic
1173638441 20:44581779-44581801 CAGTGGCCTCTGACTTCTCCAGG + Intronic
1181956158 22:26589507-26589529 CAGTGACCTCCAAGTTCACTAGG + Intronic
1185209468 22:49561584-49561606 CCGTGACCTCTGATGTCACCGGG - Intronic
952151267 3:30595230-30595252 TACTGCCATGTGATTTCACTAGG + Intergenic
956426857 3:69144908-69144930 CATTGCCCTCTGATTTCCAAAGG - Intergenic
956490939 3:69771280-69771302 CAGTGAGCTCTGATTTAAATTGG + Intronic
958020887 3:87994573-87994595 CACTGCCCTCTGATCTGAGTTGG + Intergenic
959371973 3:105538178-105538200 CAATGCCATCAAATTTCACTTGG - Intronic
960250508 3:115446677-115446699 CATTTTCCTCTGAATTCACTTGG + Intergenic
960970330 3:123134854-123134876 CAGAGCCCTCTGCTCACACTCGG - Intronic
961811117 3:129522382-129522404 CAGTGTCCTCTTAGTTCAATGGG - Intergenic
961981897 3:131088106-131088128 CGGGGCCCTCTGATTTTCCTGGG + Intronic
963610276 3:147458256-147458278 CAATTCCCTCTGATTTCCCAGGG + Intronic
963698810 3:148598126-148598148 AAGTGCCCTGGGTTTTCACTTGG - Intergenic
965327487 3:167325173-167325195 CAGTGCCTGCTATTTTCACTTGG + Intronic
967790636 3:193545322-193545344 CAGGACACTCTGATTTCAGTGGG - Intronic
973792023 4:54386573-54386595 CAGTGCCTTCTGGTCTCCCTAGG + Intergenic
976377747 4:84364336-84364358 CAGAGCCCACTGATTGAACTGGG + Intergenic
978440707 4:108730401-108730423 CAGTATCCTCTGTTTTCCCTTGG + Intergenic
979417068 4:120455022-120455044 GAGTGCACTGTGATTCCACTAGG + Intergenic
980755955 4:137160809-137160831 CTGTGCCCCATGATATCACTAGG - Intergenic
985199192 4:187466662-187466684 AAGTGTCCTCTGACATCACTGGG - Intergenic
990270805 5:54136821-54136843 CTGTCCCCTCTGACTTTACTGGG + Intronic
991924695 5:71693433-71693455 TAGTGCACTATGATTACACTTGG - Intergenic
999473448 5:151876680-151876702 CAGTGCCATGTGACTTCCCTTGG + Intronic
1000448426 5:161354105-161354127 CAGTGTCCTCAGATTTTATTGGG + Intronic
1001600332 5:172924170-172924192 CAGTGCCCTCTGCCCTCTCTGGG + Intronic
1003226585 6:4211449-4211471 TACGGCCTTCTGATTTCACTAGG - Intergenic
1005003993 6:21270026-21270048 CTGTGCCCTCTGAAGTCTCTAGG + Intergenic
1005455749 6:26018026-26018048 CGGTACCCTCTGATGTTACTGGG - Intergenic
1006806535 6:36792880-36792902 CAGTGGCCCCTGACTACACTGGG - Intronic
1007935413 6:45728096-45728118 CAGGGAGCTCAGATTTCACTGGG + Intergenic
1014870623 6:126591757-126591779 CAGTGCACTCTCATTTCTTTGGG - Intergenic
1015068164 6:129056263-129056285 CAGCACCCTCTTATTTCACCAGG + Intronic
1021515379 7:21478563-21478585 CAGTGACATATGACTTCACTAGG - Intronic
1023065528 7:36373761-36373783 CAGTTGCTTCTGATTGCACTTGG - Intronic
1023355010 7:39357645-39357667 AACTGCCACCTGATTTCACTTGG + Intronic
1023684787 7:42723194-42723216 CAGTCCCCACTGACTACACTGGG - Intergenic
1024184384 7:46934687-46934709 CATTGCACTATGATATCACTAGG - Intergenic
1024247901 7:47484343-47484365 AAGTGCCCTCTGTGTTCACTTGG - Intronic
1026874733 7:73872579-73872601 TAGGCCCCTCTGACTTCACTAGG + Intergenic
1028978099 7:96936440-96936462 CAGAGCCCTCTGATTCCAGATGG + Intergenic
1029276730 7:99409504-99409526 CAGGGCCCTCGAATTTCCCTGGG + Intronic
1029954184 7:104620249-104620271 CAGTGCCCTCTGAATTGTCCAGG - Intronic
1032196322 7:129790917-129790939 AAGTGCCCTCTGAGTGAACTTGG - Intergenic
1032934362 7:136711767-136711789 CAGTACCCTCTGAGTTGACCAGG + Intergenic
1033354141 7:140585857-140585879 CAGCAGTCTCTGATTTCACTGGG + Intronic
1037387586 8:18360030-18360052 CTGTGCCCTTTTATTTCACCTGG - Intergenic
1038910885 8:31963033-31963055 CAGTGCCTTGTAATTTGACTTGG + Intronic
1039619735 8:38985553-38985575 CAGTGCCCTCTGATTTCACTAGG - Intronic
1040893433 8:52340545-52340567 CAGTGGCCTGTGATATCACCTGG + Intronic
1043975398 8:86579632-86579654 GCTTGCCCTCTGACTTCACTTGG + Intronic
1044445341 8:92268905-92268927 CAGTGACATTTGATTTCACCAGG + Intergenic
1046882914 8:119330336-119330358 CATTGAATTCTGATTTCACTGGG - Intergenic
1049968622 9:801488-801510 CAGTGCCCTCTGAACTCAAAAGG - Intergenic
1050825463 9:9940000-9940022 AAGTGCCATCTGTTTTCACCTGG - Intronic
1053200243 9:36147315-36147337 CAGTCCCCTCTGCTCTCCCTAGG + Intronic
1054748787 9:68883269-68883291 AAGTGCTCTCTGATTCCTCTCGG + Intronic
1055499801 9:76891643-76891665 AAGTGCCCTGTATTTTCACTCGG + Intronic
1056689297 9:88792989-88793011 CAGGGTTCTCAGATTTCACTTGG + Intergenic
1060211303 9:121712139-121712161 CAGTGCCCTCTCCTCTCTCTGGG - Intronic
1060693451 9:125685521-125685543 CAGTGACCCCTCATTTCACTTGG - Intronic
1062183219 9:135202361-135202383 CTGTGGCCTCTGTTTTCGCTGGG + Intergenic
1185766749 X:2731860-2731882 CAGAGCCATCTGATTCCACAAGG - Intronic
1186824827 X:13329052-13329074 CAGTGCCATGTGAATTCCCTGGG - Intergenic
1188103278 X:26117118-26117140 CAGTTCCATCTGATTTCATGAGG + Intergenic
1188408500 X:29842075-29842097 CAGTGCCCAGAGATTTTACTGGG + Intronic
1188444277 X:30240181-30240203 CAGTCCCCTCAGTTCTCACTCGG - Intergenic
1190131498 X:47752485-47752507 CAGTGTCCAATGACTTCACTAGG + Intergenic
1190375500 X:49784886-49784908 CTTTGCCCTCAGATTTCAGTTGG + Intergenic
1192951614 X:76023776-76023798 CATTGCCATCTGATTTCATGAGG - Intergenic
1195989061 X:110664912-110664934 CAGCGCCCTCTTTTTTCCCTTGG - Intergenic
1196893269 X:120310284-120310306 CCAAGCCCTGTGATTTCACTGGG - Intronic
1196894045 X:120316016-120316038 CATTGCACTATGATGTCACTAGG - Intergenic
1198601735 X:138291501-138291523 CAGTTCCCACTGGCTTCACTGGG - Intergenic
1199339552 X:146660830-146660852 GAGTACCACCTGATTTCACTGGG - Intergenic
1200000882 X:153059167-153059189 CAGTGCCCTCACAGTTGACTTGG + Intronic