ID: 1039620194

View in Genome Browser
Species Human (GRCh38)
Location 8:38989907-38989929
Sequence CTGTGTATGTAGATTTTTCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 2, 3: 77, 4: 553}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039620192_1039620194 -5 Left 1039620192 8:38989889-38989911 CCAAGTTCTATGTAAATTCTGTG 0: 1
1: 0
2: 0
3: 35
4: 363
Right 1039620194 8:38989907-38989929 CTGTGTATGTAGATTTTTCTGGG 0: 1
1: 0
2: 2
3: 77
4: 553
1039620191_1039620194 -4 Left 1039620191 8:38989888-38989910 CCCAAGTTCTATGTAAATTCTGT 0: 1
1: 0
2: 0
3: 35
4: 370
Right 1039620194 8:38989907-38989929 CTGTGTATGTAGATTTTTCTGGG 0: 1
1: 0
2: 2
3: 77
4: 553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039620194 Original CRISPR CTGTGTATGTAGATTTTTCT GGG Exonic
906006154 1:42472933-42472955 ATGTGTATGTATATATATCTTGG - Intronic
906433164 1:45772584-45772606 CTGTCTGTTTAGATTCTTCTTGG - Intergenic
907720757 1:56969885-56969907 GTGTGTATATACATTTTTCTGGG + Intergenic
908018633 1:59876366-59876388 CTGTGTCTGTTGATTTTGATGGG + Exonic
908109470 1:60880804-60880826 TTGGGTATGTAGATTGTTCCTGG - Intronic
909872179 1:80755456-80755478 CTGCCTATGTAGAAATTTCTAGG + Intergenic
910187609 1:84560354-84560376 CTGTCTGTTCAGATTTTTCTTGG - Intronic
910395191 1:86786234-86786256 CTGAATCTGTAGATTGTTCTGGG + Intergenic
910779311 1:90911217-90911239 GTGTGTCTATACATTTTTCTGGG - Intergenic
910868242 1:91807374-91807396 GTTTGGATGTAGATTTTGCTTGG - Intronic
911421527 1:97647243-97647265 ATGTGTATTTAAATTTTTATTGG - Intronic
911771163 1:101744234-101744256 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
911944107 1:104084186-104084208 GTGTGTATGTACACTTTTGTTGG - Intergenic
912985466 1:114424439-114424461 ATGTGTATGTTTATTTTTCTGGG + Intronic
913390484 1:118305526-118305548 ATGTGTATATACATTTTTCCTGG - Intergenic
913468445 1:119167459-119167481 ATGCCTATGTAGATTTTTATTGG + Intergenic
913670076 1:121088987-121089009 GTGTGTGTGTCGATTTATCTGGG + Intronic
914021841 1:143876383-143876405 GTGTGTGTGTCGATTTATCTGGG + Intergenic
914660327 1:149784334-149784356 GTGTGTGTGTCGATTTATCTGGG + Intronic
914750222 1:150529932-150529954 CTGTGTGTGTGCATTTTTCTGGG + Intergenic
914864568 1:151415808-151415830 CTGTGTGTGTGCATTTTTCAAGG - Intronic
915708916 1:157874486-157874508 CTGTGTATGTATTATATTCTAGG - Intronic
915909744 1:159907158-159907180 CTGTCTGTTCAGATTTTTCTTGG - Intergenic
916012680 1:160720072-160720094 TTGTTCATTTAGATTTTTCTAGG - Intergenic
916126484 1:161576050-161576072 CTGTGTGTTTAGATTCTTCTTGG + Intergenic
916136403 1:161657890-161657912 CTGTGTGTTTAGATTCTTCTTGG + Intronic
917374982 1:174342028-174342050 ATGTGTAAGTATATTTTCCTAGG + Intronic
918053751 1:180999916-180999938 GTTTGTATGTAGAGATTTCTGGG - Intronic
918581179 1:186131755-186131777 CTGTGTGTGTAAATTTATGTAGG - Intronic
918672910 1:187242425-187242447 CTATAAATATAGATTTTTCTAGG - Intergenic
919424671 1:197415467-197415489 CTTTGTGTGTTTATTTTTCTAGG + Intronic
920326122 1:205165645-205165667 AAGGGTATGTAGATTTTTCTTGG - Intronic
922634249 1:227149568-227149590 TTGTGTTTGTTGATTTTTTTAGG - Intronic
922818412 1:228467789-228467811 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
923231273 1:231988782-231988804 GTGTGTAGGTACATTTTTATGGG - Intronic
923661816 1:235963868-235963890 CTGTGTACTTAGGTTTTTTTTGG - Intergenic
923850954 1:237794119-237794141 CTGAGTCTTTAGATTTTTCTTGG - Intronic
923920237 1:238555750-238555772 CTGGGTATGCTGATTTCTCTGGG + Intergenic
924029742 1:239874263-239874285 CTGTGTATATAGATATATATAGG - Intronic
1062933162 10:1365768-1365790 CTGTGTATGAAGGTTTCTCTAGG - Intronic
1063281411 10:4633368-4633390 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
1063327422 10:5118346-5118368 CTATGTGTCTAGATTCTTCTTGG + Intronic
1063523269 10:6760079-6760101 CTGGGTATGTAGAATGTTCAAGG + Intergenic
1063972402 10:11390248-11390270 CTGTCTCTCTAGATTCTTCTTGG - Intergenic
1064284772 10:13982609-13982631 CTGTCTGTCTAGATTCTTCTTGG - Intronic
1064647068 10:17470684-17470706 CTTTCTATCTAGATTCTTCTTGG - Intergenic
1065006662 10:21386812-21386834 CTGTGTGTTCAGATTCTTCTTGG - Intergenic
1065449867 10:25845734-25845756 CTGTTTTTTCAGATTTTTCTGGG - Intergenic
1068170015 10:53381096-53381118 CTGTTTATGAAAATTTTACTGGG - Intergenic
1068792619 10:61043801-61043823 GTGTACATGTAGATTTTTCTGGG + Intergenic
1069235552 10:66067347-66067369 CTGTCTGTCTAGATTTTTCTTGG - Intronic
1069295545 10:66839585-66839607 TTGTCTATGTATAATTTTCTGGG - Intronic
1070601137 10:77867178-77867200 CTGAGTAGGAAGATATTTCTTGG - Intronic
1071195536 10:83154634-83154656 CTCTGTATGTTAATTTCTCTAGG + Intergenic
1071427189 10:85571055-85571077 CTGTCTGTCTAGATTCTTCTGGG + Intergenic
1071805801 10:89119610-89119632 CTGTGTATGTGTTTTCTTCTTGG - Intergenic
1072074333 10:91954047-91954069 CTGTACATGTGGATTTTTCTGGG - Intronic
1072851891 10:98904546-98904568 CTTTGTATTTAAATTATTCTGGG - Intronic
1073001781 10:100291112-100291134 CTGAGTATGAAGATTTTTAAAGG + Intronic
1073710831 10:106038582-106038604 GTGTGTTTTTATATTTTTCTGGG + Intergenic
1073937953 10:108657523-108657545 CTGTGTATGTAGAAATTTTATGG + Intergenic
1074191687 10:111143528-111143550 CTGTTTATTTAGATTTTGTTTGG + Intergenic
1074660623 10:115652775-115652797 CTGTTTATTTAAATTTTACTTGG + Intronic
1075007563 10:118841799-118841821 CTGTGTCTATAGAGTTTTATTGG - Intergenic
1076029597 10:127146082-127146104 ATGAGTATGGAGATTTTTCTGGG - Intronic
1076647903 10:131966037-131966059 ATGTGCATGTAGAAGTTTCTAGG + Intergenic
1077969181 11:7169796-7169818 CTGTGTATGTATATAGTTCGGGG + Intergenic
1078883372 11:15475629-15475651 CTGAGATTGTAGATTTTTCAGGG + Intergenic
1078962468 11:16293754-16293776 CTATTTAGGTAGATTTTTGTTGG - Intronic
1079676426 11:23232560-23232582 CTGTCTGTTCAGATTTTTCTTGG + Intergenic
1080491747 11:32772021-32772043 CTGAGTTTGTAGATTGTTGTGGG - Intronic
1081443800 11:43109853-43109875 CTGGGGATATAGTTTTTTCTTGG - Intergenic
1081769843 11:45643172-45643194 CAGGGTAGGTAGATGTTTCTAGG + Intergenic
1083280456 11:61623809-61623831 CTGTGTGTGTACATTCTTCTTGG - Intergenic
1083488390 11:62997523-62997545 CTGAGCATCAAGATTTTTCTAGG - Intronic
1084687712 11:70706724-70706746 CTTTCAGTGTAGATTTTTCTAGG - Intronic
1085991195 11:81846835-81846857 CTGTTTATTTATATTCTTCTAGG - Intergenic
1086288347 11:85274857-85274879 CTGTCTGTTTAGATTATTCTTGG - Intronic
1086464818 11:87042235-87042257 CTGTCTGTCTAGATTCTTCTTGG + Intronic
1086524962 11:87714367-87714389 CTGTATGTCTAGATTCTTCTTGG + Intergenic
1086531154 11:87786754-87786776 CTGTTTGTGCAGATTCTTCTTGG + Intergenic
1086837888 11:91648261-91648283 CTGTTTATGCAGAAATTTCTAGG - Intergenic
1086912719 11:92491585-92491607 CTGTATATGTAGGAATTTCTGGG + Intronic
1087020366 11:93596404-93596426 CTGTGTGTCCAGATTCTTCTTGG - Intergenic
1087623020 11:100564261-100564283 CTGTTTATTCAGATTCTTCTTGG + Intergenic
1087645127 11:100800090-100800112 ATGTTTTTGTGGATTTTTCTAGG + Intronic
1087803589 11:102531482-102531504 CCGTGCTTGTAGATTTTTGTTGG - Intergenic
1087916225 11:103814663-103814685 CTCTGTAAATAGATTTTTCTAGG + Intergenic
1089943254 11:122441124-122441146 ATGTGTATGTATATATTTTTTGG - Intergenic
1090613297 11:128491337-128491359 CTGTGTAGATAGATTTTTAGTGG - Intronic
1091251729 11:134149620-134149642 CTGTGTAAGAAGCCTTTTCTGGG - Exonic
1091938765 12:4455136-4455158 CTGTCTGTTCAGATTTTTCTTGG - Intergenic
1092042459 12:5396527-5396549 CTGTGTATGTCCCCTTTTCTGGG - Intergenic
1093006912 12:14061052-14061074 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
1093108696 12:15122097-15122119 GTGTGTATGTATATTTTTTCAGG - Intronic
1094353176 12:29549066-29549088 CTTTGTATGTTCATTTTTCTTGG - Intronic
1095330864 12:40961607-40961629 ACGTGTATGTACATTTTCCTGGG + Intronic
1095541299 12:43311307-43311329 CTGTCTGTCTAGGTTTTTCTTGG - Intergenic
1095865894 12:46971787-46971809 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
1096859424 12:54513496-54513518 CTGTGTATGTTGATATTTAAGGG + Intronic
1097557437 12:61156754-61156776 CTGTCTGCCTAGATTTTTCTTGG + Intergenic
1098114499 12:67160789-67160811 CTGAGTCTGTAGATTTCCCTCGG + Intergenic
1098291766 12:68963253-68963275 CTGTCTGTCTAGATTCTTCTTGG - Intronic
1098475181 12:70892842-70892864 CTATGTCTGTAGATTTTTTGTGG + Exonic
1098487398 12:71037306-71037328 CCGTCTATGTACATTCTTCTTGG + Intergenic
1098734558 12:74082370-74082392 GTGTGTATTTAAAATTTTCTGGG + Intergenic
1098961144 12:76740698-76740720 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
1099599935 12:84722075-84722097 CTGTCTATTCAGATTCTTCTTGG - Intergenic
1099612278 12:84889075-84889097 CTGTCTGTTCAGATTTTTCTTGG - Intronic
1100093653 12:91004788-91004810 CTTTGTATTTATATTATTCTTGG - Intronic
1100413365 12:94345742-94345764 CTGTGCATTTAGATTCTTCTTGG - Intronic
1100864538 12:98842895-98842917 CTATGTATGTATATTTTTGAGGG + Intronic
1100882610 12:99035384-99035406 CTGTCTGTCTAGATTCTTCTTGG - Intronic
1101214196 12:102564212-102564234 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
1101541497 12:105669628-105669650 GTGTGTATGTACACATTTCTGGG + Intergenic
1101800861 12:108020964-108020986 CTCTGTATGTGTACTTTTCTGGG - Intergenic
1101973567 12:109335214-109335236 CTGTGAATATTGATGTTTCTGGG + Intergenic
1102732076 12:115120516-115120538 ATGTGTTTGTACATTTTTATTGG + Intergenic
1102852900 12:116267356-116267378 TTGTGTTTGTATTTTTTTCTAGG - Intronic
1103539405 12:121655398-121655420 GTGTTTATGTTCATTTTTCTGGG - Intronic
1104080256 12:125423961-125423983 GTGTGTATTTGCATTTTTCTGGG - Intronic
1104242768 12:127006902-127006924 ATGTGTGTGTAGATGTTTGTAGG - Intergenic
1105210719 13:18255285-18255307 CTGTGTGTGTTTGTTTTTCTTGG - Intergenic
1107407029 13:40124120-40124142 CTGTTTATGTGTACTTTTCTGGG - Intergenic
1108256169 13:48613090-48613112 CTGTCTGTGCAGATTCTTCTTGG + Intergenic
1108396144 13:49993899-49993921 CTGTGTATGCAGGTTTTAGTTGG + Intergenic
1108737625 13:53301203-53301225 CAATGTATGGAGATGTTTCTTGG + Intergenic
1108877325 13:55062182-55062204 CTGTATATTTGGCTTTTTCTGGG - Intergenic
1108885926 13:55181346-55181368 GGGTTTATTTAGATTTTTCTGGG - Intergenic
1109470886 13:62802091-62802113 CTGTCTGTTTAGATTCTTCTTGG - Intergenic
1109524027 13:63551938-63551960 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
1109528607 13:63608794-63608816 CTGTGTATGTATATGTGTTTTGG + Intergenic
1109572243 13:64207768-64207790 TTGTCTATGTAGATTTTTGCAGG + Intergenic
1109593818 13:64523523-64523545 CTGTCTGTTTAGATTATTCTTGG + Intergenic
1109604363 13:64673222-64673244 CTTAGTATGTAGGTGTTTCTAGG + Intergenic
1109859933 13:68184160-68184182 CAGTGTATCTACATTTTTATGGG - Intergenic
1109965276 13:69684723-69684745 CTGTTTGTTTAGATTTTTCTTGG + Intergenic
1110476093 13:75915914-75915936 CTTTCCCTGTAGATTTTTCTTGG + Intergenic
1110871861 13:80461679-80461701 CTGTGTGTCTAGATCCTTCTTGG - Intergenic
1110918669 13:81056873-81056895 CTGTATATTCAGATTCTTCTTGG + Intergenic
1111307887 13:86439641-86439663 CTGTCTTTCTAGATTCTTCTTGG - Intergenic
1111551106 13:89814032-89814054 CTCTGTTTGTAGAGTTTTATGGG - Intergenic
1111856444 13:93643566-93643588 CTGTTTGTACAGATTTTTCTGGG + Intronic
1112167263 13:96932723-96932745 ATGTGTAGGTACATTGTTCTTGG + Intergenic
1112540812 13:100310822-100310844 TTGTATAGGTAGATTTTTCCAGG + Intronic
1112604359 13:100889705-100889727 ATGTATATGTGTATTTTTCTGGG - Intergenic
1113839924 13:113353290-113353312 CTGGGTATGTGGATTCTGCTGGG - Intronic
1114242595 14:20882399-20882421 CTGTCTGTTTAGATTTTTCTTGG + Intergenic
1114249526 14:20946326-20946348 CTGTCTGTTTAGATTTTTCTTGG + Intergenic
1114589733 14:23850485-23850507 GTGTGTATGTATATATGTCTAGG + Intergenic
1115322876 14:32104041-32104063 TTGTGCATGTGCATTTTTCTAGG - Intronic
1115423212 14:33222110-33222132 CTGTGTGTTCAGATTTTTCTTGG + Intronic
1115591315 14:34868141-34868163 CTGTTTTTGTAGATTTTTTGGGG + Intronic
1116558711 14:46347821-46347843 GAGTTTTTGTAGATTTTTCTTGG + Intergenic
1116737330 14:48708641-48708663 CTTTGTGTGTTGATTTTTCCTGG - Intergenic
1116773613 14:49154799-49154821 TTGTGTGTGCAGATTTCTCTAGG - Intergenic
1117554235 14:56868184-56868206 AAATGTATCTAGATTTTTCTGGG - Intergenic
1118065759 14:62188617-62188639 CTGTGTTTGTGGATCTCTCTGGG + Intergenic
1118804893 14:69227479-69227501 TTTTGTATGTACATTTTTCTAGG + Intronic
1118847054 14:69555342-69555364 CCGTGTAAGCAGATTTTTGTGGG + Intergenic
1119068595 14:71556849-71556871 CTGTCTATTCAGACTTTTCTTGG + Intronic
1119308926 14:73630551-73630573 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
1119864623 14:77962974-77962996 CTGTCTATCTAGATGTTTCTTGG - Intergenic
1120362520 14:83523802-83523824 CTGTGTGTGTATATTTTCCTCGG - Intergenic
1121843108 14:97150979-97151001 CTGTTTTTGTAGAATGTTCTGGG + Intergenic
1122000552 14:98648039-98648061 CTGTGTATGTCAGTTTTCCTTGG - Intergenic
1122141446 14:99665325-99665347 CTGTGTGTCTGGATTCTTCTTGG + Intronic
1122391763 14:101394038-101394060 CTTTGTAGGTATATTTTGCTGGG + Intergenic
1123456691 15:20432767-20432789 CTGTTTTTGTAAATTTTTATGGG - Intergenic
1123479703 15:20619820-20619842 CTGTGTGTTCAGATTCTTCTTGG - Intergenic
1123638303 15:22380544-22380566 CTGTGTGTTCAGATTCTTCTTGG + Intergenic
1123661371 15:22567593-22567615 CTGTTTTTGTAAATTTTTATGGG + Intergenic
1124145255 15:27119122-27119144 CTGTGTGTTCAGATTCTTCTTGG - Intronic
1124262837 15:28207909-28207931 CTGTTTTTGTAAATTTTTATGGG - Intronic
1124421595 15:29527725-29527747 GTGTGTGTGTTTATTTTTCTGGG - Intronic
1124903086 15:33842621-33842643 CTGTGGATGCTGATTTTTCTGGG + Intronic
1125391758 15:39200039-39200061 CTGAGAATGTAATTTTTTCTGGG + Intergenic
1126124095 15:45279675-45279697 ATGTGTATGGACATCTTTCTAGG + Intergenic
1126311897 15:47326882-47326904 CTATGTATTTAGAATTTTCCAGG - Intronic
1126326748 15:47486715-47486737 CTGAGTACGTACATTTTTATAGG + Intronic
1126360272 15:47838392-47838414 CTATGTATTTACATTTATCTGGG + Intergenic
1126951387 15:53885444-53885466 CTGTCTGTTGAGATTTTTCTTGG - Intergenic
1127211271 15:56777208-56777230 CTGTATATTCAGATTCTTCTTGG - Intronic
1127270917 15:57401131-57401153 CTGTGTATATAAATTTTTGTTGG + Intronic
1127542957 15:59961174-59961196 CTGTGTTTGTTGATTTTTTTTGG - Intergenic
1128888539 15:71310572-71310594 CTGCCTATCTAGATTCTTCTTGG + Intronic
1128958606 15:71975716-71975738 CTGTTTGTCTAGATTCTTCTTGG - Intronic
1129559034 15:76546157-76546179 CTTGGTGTGTAGATTTTTCCTGG - Intronic
1129819116 15:78584645-78584667 GTGTGTGTGCACATTTTTCTAGG + Intronic
1129861276 15:78864222-78864244 CTGTGTATATGCATTTTTCGGGG + Intronic
1130044565 15:80433918-80433940 CTGTCTGTTTAGATTCTTCTTGG + Intronic
1130426834 15:83809925-83809947 CTGTGGATCAAGTTTTTTCTTGG + Intronic
1130556637 15:84927471-84927493 CTGTCTGTGTAGACTCTTCTTGG + Intronic
1130737580 15:86566282-86566304 TTGAGTATGCACATTTTTCTAGG + Intronic
1131008466 15:88997720-88997742 CTGTTTGTGTAGATTCTTCTTGG - Intergenic
1131370690 15:91878726-91878748 CTGTGAATGAAAATTTTTCTGGG - Intronic
1132158804 15:99517761-99517783 CTGTGCATGTGGAGTTTTCCAGG + Intergenic
1132436563 15:101809717-101809739 CTTGGCATATAGATTTTTCTTGG + Intronic
1133664182 16:7949408-7949430 CTGTATTTGTAGTTATTTCTTGG - Intergenic
1134331661 16:13256914-13256936 GTGTGTATGTGTATGTTTCTGGG - Intergenic
1135334814 16:21592440-21592462 CTGTTTATGCAGAAATTTCTAGG - Intergenic
1135860592 16:26052165-26052187 CTCTCTGTCTAGATTTTTCTTGG - Intronic
1135961992 16:27002775-27002797 CTGTGACTGTTGGTTTTTCTGGG - Intergenic
1137577101 16:49607425-49607447 CTGTGTATGTTGATGTTTGATGG + Intronic
1138780155 16:59775294-59775316 CTGTGTGTAGAGATTCTTCTTGG - Intergenic
1138787500 16:59864623-59864645 CTGTCTATCTAGATTCGTCTTGG + Intergenic
1139597216 16:67965209-67965231 CTGGGTTTTCAGATTTTTCTTGG - Intronic
1139933090 16:70545644-70545666 CTGTTTCTGTAAATTTTTATTGG + Intronic
1139970117 16:70769114-70769136 CTGTGGATGTGCATTTTTTTTGG + Intronic
1140335706 16:74103270-74103292 TTGTCTATGCAGATTCTTCTTGG + Intergenic
1140960320 16:79905798-79905820 CTAGGTATGGAGATTTTTCTGGG - Intergenic
1141032621 16:80602816-80602838 CTGAGAATCTAGCTTTTTCTGGG + Exonic
1141159613 16:81620477-81620499 CTGTGTATGAGGACTGTTCTAGG - Intronic
1141684864 16:85564446-85564468 AGGTGTGTGTAGAATTTTCTGGG + Intergenic
1142423695 16:89989314-89989336 CTGTGAATGCAAATATTTCTGGG - Intergenic
1142790641 17:2262084-2262106 CTATGGATTTACATTTTTCTGGG - Intronic
1144107554 17:11999274-11999296 ATGTGTATGTGCATTTTTCTTGG - Intergenic
1144248446 17:13391808-13391830 CTGTGGTTATAGATTTTTGTGGG + Intergenic
1144391667 17:14799164-14799186 CTGTCTGTGTAAATTCTTCTTGG + Intergenic
1147478292 17:40734893-40734915 TTTTGTATGTAGTTTTTTATAGG + Intergenic
1148112236 17:45151741-45151763 ACTTGTATGTACATTTTTCTGGG + Exonic
1149575519 17:57708966-57708988 ATGTGTATCTAGTTTTTTTTGGG + Intergenic
1150689249 17:67350007-67350029 TGGTATATCTAGATTTTTCTGGG - Intronic
1151708093 17:75782544-75782566 CTGTGTTTCACGATTTTTCTAGG + Intronic
1151741044 17:75982206-75982228 CTGTCTGTCTAGATTCTTCTTGG - Intronic
1153409509 18:4778188-4778210 CTATCTATTTAGATTCTTCTTGG + Intergenic
1153489992 18:5636951-5636973 CTGTGTTTGGAAATATTTCTAGG - Intergenic
1153504506 18:5782023-5782045 CTGTCCATCTAGATTCTTCTTGG + Intergenic
1153505132 18:5789113-5789135 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
1155152149 18:23131560-23131582 CTGTGGATGTAGAAGTTGCTTGG + Intergenic
1155791745 18:29980344-29980366 TTGTGTTTTTAGATGTTTCTTGG - Intergenic
1156244106 18:35281476-35281498 ATATGAATGTAGATTTTTTTGGG - Intronic
1156624926 18:38897261-38897283 CAGTGAATGTGCATTTTTCTAGG - Intergenic
1156636189 18:39032351-39032373 CTGTCTATGGAGATACTTCTTGG + Intergenic
1156701788 18:39834816-39834838 CTGTCCATCTAGATTCTTCTTGG - Intergenic
1156936161 18:42710387-42710409 CTTGGTATGTAGTTTTTCCTTGG + Intergenic
1157092362 18:44651323-44651345 CTGTGTTTGTAGATCATCCTTGG + Intergenic
1157174976 18:45443418-45443440 CTGTCTGTCTAGATTCTTCTTGG + Intronic
1157399416 18:47374790-47374812 ATGTTTATGTACATTCTTCTGGG + Intergenic
1157951268 18:52040592-52040614 CTGTATATGTATTTTCTTCTTGG - Intergenic
1158755875 18:60324525-60324547 CTGAATCTGTAGATTTCTCTGGG + Intergenic
1159188071 18:65004800-65004822 CTGTGCATGTTAATTTTTCTGGG - Intergenic
1159232742 18:65630077-65630099 CTGTCTGTTTAGATTCTTCTTGG + Intergenic
1162604815 19:11698401-11698423 CTGTCTGTCTAGATTTTTCTTGG - Intergenic
1162680339 19:12335719-12335741 CTGTGTGTCTAGATTGTTCTTGG - Intergenic
1162710894 19:12593944-12593966 CTGTGTAGGTTGCTGTTTCTAGG + Intronic
1162766072 19:12920326-12920348 CTATCTATCTAGATTCTTCTTGG + Intergenic
1162880470 19:13655105-13655127 CTGTCTATCTAGATTCTTCTTGG - Intergenic
1162990758 19:14300586-14300608 CAGTTTATGTAGAAATTTCTAGG - Intergenic
1163308786 19:16499703-16499725 CCGTATGTGTATATTTTTCTAGG - Intronic
1163506758 19:17712057-17712079 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
1163785342 19:19272299-19272321 CTGTGTACAAAGATTTGTCTTGG - Intronic
1163970791 19:20792491-20792513 GTGTGTGTGTATATTTTTCAGGG + Exonic
1164462235 19:28458872-28458894 TTGTATGTGCAGATTTTTCTTGG - Intergenic
1164882635 19:31747208-31747230 GTGTGTATGTAGATATATATAGG + Intergenic
1164897519 19:31890241-31890263 CTGTTTATGTAGAAATTTCTAGG + Intergenic
1165121446 19:33561443-33561465 CTGTCTATCTAGATTCTTCTTGG + Intergenic
1165455156 19:35906456-35906478 TTTTTTGTGTAGATTTTTCTGGG + Intronic
1166126651 19:40718772-40718794 ATTTGTATGTACATTTTTCTAGG + Intronic
1166246084 19:41527440-41527462 CTGTGTATGTAGTTTTTTCAGGG - Intergenic
925449289 2:3954218-3954240 CTGTGTGTGGTGATTTTTTTTGG + Intergenic
927206230 2:20612515-20612537 CTGTCTCTGTAGATTTGTCCTGG + Intronic
927362204 2:22249223-22249245 CTGTGTAAGTAGATTCCTGTAGG - Intergenic
927371809 2:22364477-22364499 CTGAGTCTTTAGATTTTTCTAGG + Intergenic
928252492 2:29694053-29694075 CTGAGTTAGTAGAGTTTTCTAGG + Intronic
928852242 2:35762677-35762699 ATGTGTATATATATTTCTCTGGG + Intergenic
928908365 2:36392522-36392544 CTGTGTATGTGGATTTACTTAGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930378194 2:50594389-50594411 ATGTGCATGTTGATTTTTTTAGG - Intronic
931236795 2:60418857-60418879 CTGTGTCTCTACTTTTTTCTGGG + Intergenic
931436110 2:62248423-62248445 CTGTGTGTCTACATTCTTCTTGG - Intergenic
931448624 2:62348510-62348532 CTCTCTGTCTAGATTTTTCTTGG - Intergenic
931454440 2:62397130-62397152 CAGTCTATGTCAATTTTTCTTGG + Intergenic
933012629 2:77087352-77087374 CTGTGATTGTAGATTTTTATGGG - Intronic
934119245 2:88824196-88824218 GTGTATAGGTACATTTTTCTTGG - Intergenic
935761623 2:106325834-106325856 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
936162700 2:110096694-110096716 GTGTGTAGGTACATTTTTCTTGG - Intronic
936619974 2:114085338-114085360 TTGTGTACTTACATTTTTCTAGG + Intergenic
936829210 2:116621706-116621728 CTGAATCTGTAGATTTCTCTGGG - Intergenic
936947841 2:117946535-117946557 CTGTTTAGGGAGATGTTTCTGGG - Intronic
937187416 2:120057429-120057451 ATGTGTATGTGCATTTTTCTAGG - Intronic
937629527 2:124084869-124084891 CTGTGTCTAGAGATTTTTTTGGG + Intronic
938297897 2:130189724-130189746 GTGTGGTTGCAGATTTTTCTTGG + Intronic
938458867 2:131484944-131484966 GTGTGGTTGCAGATTTTTCTTGG - Intronic
938647695 2:133348347-133348369 CTGTGTGTGTAGTTTTATTTGGG + Intronic
938825964 2:135005593-135005615 GAGTGAATGTTGATTTTTCTGGG + Intronic
938943950 2:136193526-136193548 CTGTGTGTCTAGATTCCTCTTGG - Intergenic
939162909 2:138610386-138610408 CTGTCTGTTCAGATTTTTCTTGG - Intergenic
939318634 2:140586309-140586331 CTGTGTATGTTGCCATTTCTGGG - Intronic
939911881 2:147993046-147993068 CTGTCTGTATAGATTCTTCTTGG - Intronic
940175261 2:150871236-150871258 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
940223828 2:151381671-151381693 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
941091602 2:161182786-161182808 CTGTCTATTCAGATTCTTCTTGG + Intronic
941267715 2:163383824-163383846 TTGTGTATGTAAATTTCTTTGGG + Intergenic
941423403 2:165312742-165312764 CTGTGTTTTTAAATTTTCCTAGG - Intronic
941571742 2:167179109-167179131 CTTTTTATGTATATTTTTCAAGG + Intronic
941839584 2:170066445-170066467 TTGTGTATGTGCATTTTTATTGG + Intronic
942779059 2:179619294-179619316 CTGTATATGTATATTTCTCTTGG - Intronic
943387236 2:187217105-187217127 CTGTCTATTCAGATTTTTCTTGG - Intergenic
943470073 2:188284024-188284046 CTATAGATGTACATTTTTCTTGG - Intergenic
944172549 2:196795884-196795906 GTTTGTATGTAGATTTATTTTGG - Intronic
944424419 2:199564660-199564682 CTATGTATGTATCTATTTCTGGG + Intergenic
944802185 2:203247297-203247319 CTGTATATATATATTGTTCTTGG + Intronic
944899390 2:204198733-204198755 CTGCCTGTGTAGATTCTTCTTGG - Intergenic
945933282 2:215877937-215877959 CTGTTTATTGAGATTCTTCTCGG - Intergenic
946015373 2:216599918-216599940 CTGTTTGTTTAGATTCTTCTTGG - Intergenic
946249786 2:218405186-218405208 ATGTGTATATAGATTTTTAGGGG + Exonic
947545935 2:231010362-231010384 CTGTCTGTCTAGATTCTTCTTGG + Intronic
1169411011 20:5370364-5370386 CTGTCTATTCAGATTCTTCTTGG - Intergenic
1169460066 20:5786703-5786725 CTGTCTGTCTAGATTCTTCTTGG - Intronic
1170550090 20:17469020-17469042 CTGTGTTTTTAGATTATTATAGG - Intronic
1171085211 20:22232400-22232422 ATGTGTACTTATATTTTTCTAGG - Intergenic
1171154578 20:22860387-22860409 CTGAGCATTTAGATTTTTGTAGG + Intergenic
1171291865 20:23986974-23986996 CTGTGTGTGTTTGTTTTTCTTGG - Intronic
1171568759 20:26224291-26224313 CTGTATATGAAATTTTTTCTAGG - Intergenic
1171871043 20:30525262-30525284 CTTTGTGTGTATTTTTTTCTAGG + Intergenic
1173104536 20:40121146-40121168 CTGTGTGGGTAGATGTTACTGGG - Intergenic
1173657900 20:44713753-44713775 CTGTGGATGTAAATTATTCTAGG + Intergenic
1173991122 20:47304452-47304474 CTGTGTTTATAGAGTTTTATTGG - Intronic
1174334850 20:49852320-49852342 CTGGGTTTCTAGATTTTTATAGG + Intronic
1174657807 20:52186237-52186259 CTGTGTGTGTAGGTGTTTGTGGG + Intronic
1174691554 20:52511436-52511458 CTGGGGATGTCGTTTTTTCTTGG + Intergenic
1175056730 20:56205525-56205547 CTGTCTGTGCAGATTCTTCTTGG - Intergenic
1175512449 20:59540417-59540439 ATGTGTTTGTATATTTTTCAAGG + Intergenic
1178357758 21:31922946-31922968 CTGTGTATGAAGGTGTTCCTGGG + Intronic
1178394688 21:32232167-32232189 CTATATATCTAGATATTTCTAGG + Intergenic
1179229046 21:39484112-39484134 CTGTGTCTGGACTTTTTTCTTGG + Intronic
1179235591 21:39542683-39542705 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
1179263600 21:39781521-39781543 GTGTGTATGTAGTTTTGTCACGG + Intronic
1179414432 21:41186851-41186873 CGGTGTATGCAGATACTTCTAGG + Intronic
1180765536 22:18344132-18344154 CTGTGTGTGTTTGTTTTTCTTGG + Intergenic
1180780780 22:18518260-18518282 CTGTGTGTGTTTGTTTTTCTTGG - Intergenic
1180813493 22:18775567-18775589 CTGTGTGTGTTTGTTTTTCTTGG - Intergenic
1181400084 22:22645961-22645983 CTGTGTGTGTTTGTTTTTCTTGG + Intronic
1181649280 22:24249829-24249851 CTGTGTGTGTTTGTTTTTCTTGG - Intergenic
1181702058 22:24627059-24627081 CTGTGTGTGTTTGTTTTTCTTGG + Intronic
1203227158 22_KI270731v1_random:85022-85044 CTGTGTGTGTTTGTTTTTCTTGG + Intergenic
1203263594 22_KI270734v1_random:1249-1271 CTGTGTGTGTTTGTTTTTCTTGG - Intergenic
949468954 3:4373967-4373989 CAATGGATGTAGATTTTGCTGGG - Intronic
950920517 3:16689522-16689544 CTGTGGATGTGAATTTCTCTAGG - Intergenic
951027633 3:17846431-17846453 CTGTGTGCATAGAATTTTCTTGG - Intronic
951397751 3:22190726-22190748 CTGTGTATGGATATGTTTCAAGG - Intronic
951702574 3:25511070-25511092 CTGTGTTTGTAAAGTTTTATTGG - Intronic
951771889 3:26267432-26267454 ATGGATATGTAGATTTTTATTGG + Intergenic
951790773 3:26481731-26481753 CTGTGAATGTAAACTTTTTTTGG + Intergenic
951895951 3:27609773-27609795 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
952217289 3:31290234-31290256 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
952579879 3:34820617-34820639 CTGTCTATCTAGATTCTTCTTGG - Intergenic
953724860 3:45388895-45388917 GTGTATATGTGCATTTTTCTGGG - Intronic
954062113 3:48076801-48076823 CAGTTTATCTAGTTTTTTCTTGG - Intronic
955055784 3:55454922-55454944 CTGGGTATCTGTATTTTTCTAGG - Intergenic
955488993 3:59463702-59463724 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
955543974 3:60007785-60007807 CTGTGTGTTCAGATTCTTCTTGG + Intronic
956388960 3:68751310-68751332 CTGTTTGTGTAGATCATTCTGGG + Intronic
956437546 3:69248228-69248250 GTGTGTATTTACATTTTTCTAGG - Intronic
956504645 3:69924698-69924720 CTTTGACTGTACATTTTTCTGGG - Intronic
956829726 3:73034339-73034361 TTGTGTGTGTAGAATTTTCCAGG + Intronic
956916393 3:73876348-73876370 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
957305892 3:78458464-78458486 CTGTCTGTTTAGATTTTTATTGG - Intergenic
957725420 3:84059130-84059152 TTGTTTATGTAGATTTTTGTTGG + Intergenic
957795530 3:85000819-85000841 CTATGTATGTACATTTGTATAGG + Intronic
957804011 3:85123154-85123176 CTTTTTATTTATATTTTTCTAGG - Intronic
959473770 3:106785008-106785030 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
960070770 3:113427711-113427733 CTGAGTATGCTGATTTCTCTTGG + Intronic
960190770 3:114702443-114702465 CTGTGTATGTGTATATTTATAGG - Intronic
960348788 3:116568278-116568300 CTGTGTGTGTATGTGTTTCTTGG - Intronic
962183767 3:133236506-133236528 ACCTGTCTGTAGATTTTTCTGGG + Intronic
962614770 3:137114066-137114088 CTGTTTATTCAGATTCTTCTTGG + Intergenic
963243146 3:143030930-143030952 CTGTTAATGTCGATTTTTATAGG - Intronic
964271062 3:154957442-154957464 CTGTGTCTATATTTTTTTCTGGG - Intergenic
964448450 3:156785579-156785601 ATGTGTATATGCATTTTTCTGGG + Intergenic
967089045 3:186119431-186119453 CTTGGAATGTTGATTTTTCTTGG - Intronic
967490937 3:190090051-190090073 CTCTGTAGGTAGATTTATTTGGG + Intronic
967674217 3:192276876-192276898 CTGTCTGTCTAGATTTTTCTTGG - Intronic
967820754 3:193836673-193836695 CTGTTGATGTAGTTTATTCTAGG - Intergenic
969223298 4:5775754-5775776 CTGTGTGTACATATTTTTCTTGG + Intronic
970339350 4:15088158-15088180 ATTTGTGTGTAGATATTTCTAGG + Intergenic
970697673 4:18697026-18697048 CTGTGTGTCCAGATTCTTCTTGG + Intergenic
971254662 4:25003374-25003396 ATTTGTTTGTTGATTTTTCTTGG + Exonic
971612848 4:28747425-28747447 GGGTGCATTTAGATTTTTCTTGG - Intergenic
971887208 4:32466068-32466090 ATGTGTTTGTAAATTATTCTAGG - Intergenic
972217877 4:36917126-36917148 CTGTCTATCTGGATTTTCCTTGG - Intergenic
973743995 4:53945848-53945870 CTGTGTGTTTAGGCTTTTCTTGG - Intronic
974799803 4:66802031-66802053 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
975176642 4:71297194-71297216 CAGTTAATGTAGATTCTTCTAGG - Intronic
975244273 4:72101297-72101319 ATGTTTATTTTGATTTTTCTTGG - Intronic
975464647 4:74695584-74695606 CTGTGTATATAGATTTCCCTAGG - Intergenic
975572149 4:75828476-75828498 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
975582887 4:75922497-75922519 CTGTGTGTCTAGATTCTTCTTGG - Intronic
975681732 4:76884171-76884193 CTGTGAACCTTGATTTTTCTGGG - Intergenic
976266510 4:83190506-83190528 CTGTCTGTTCAGATTTTTCTTGG + Intergenic
976286242 4:83374234-83374256 CTGTGTGTTCAGATTTATCTTGG + Intergenic
976509948 4:85896809-85896831 CTTTGAATGTAGATTGGTCTGGG + Intronic
976628787 4:87216531-87216553 CTGTATATTTATACTTTTCTGGG - Intronic
977202228 4:94130674-94130696 CTGTCTATTCAGATTCTTCTTGG - Intergenic
977399402 4:96512470-96512492 CAGTCTATGTATATTTTTATGGG - Intergenic
978215470 4:106196155-106196177 GTGTGTATGTATATATTTCTAGG - Intronic
978626074 4:110686910-110686932 CTTTGTATGAAGATTACTCTGGG + Intergenic
979350978 4:119644253-119644275 CTGTCTGTTCAGATTTTTCTTGG - Intergenic
979762227 4:124420346-124420368 CTGTCTGTTTGGATTTTTCTTGG - Intergenic
980030241 4:127819949-127819971 GTGTGTATTTTCATTTTTCTTGG + Intronic
980515100 4:133847091-133847113 CTGTGCATTTAGTTTTTACTTGG + Intergenic
980858345 4:138467983-138468005 GTGTGTATATATATTTTTATTGG + Intergenic
981285012 4:143006164-143006186 CTGTGTATCTTCATTTTTCAGGG - Intergenic
981452306 4:144912380-144912402 ATGTGTATGTATGTTTTTCTGGG - Intergenic
981651279 4:147061740-147061762 CTTTGCTTGTAGATCTTTCTAGG - Intergenic
981665381 4:147219213-147219235 CTCAGTATGTGGATTTTCCTTGG + Intergenic
981921296 4:150087688-150087710 CTGTCTGTCTAGATTCTTCTTGG + Intronic
981985940 4:150855877-150855899 CTGTGTATCTTGTCTTTTCTTGG - Intronic
982463960 4:155707139-155707161 ATCTGTATGTAGGTTTTTCTTGG + Intronic
982865496 4:160505384-160505406 CTGTGTGTTCAGATTTTTCTTGG - Intergenic
982976791 4:162073254-162073276 GTGTGTATGTATATTTTTATGGG + Intronic
983289841 4:165788051-165788073 CTGATTTTATAGATTTTTCTAGG + Intergenic
983691454 4:170474002-170474024 CTGTCTGTTCAGATTTTTCTTGG + Intergenic
984000973 4:174244198-174244220 ATGTGTATGTGCATTATTCTGGG - Intronic
985036755 4:185848057-185848079 CTGAGTCTGTCGAATTTTCTGGG - Intronic
985586272 5:738038-738060 ATGAGTATTTAGAGTTTTCTAGG - Intronic
985600861 5:830224-830246 ATGAGTATTTAGAGTTTTCTAGG - Intronic
986009171 5:3696721-3696743 CTGTTTCTTTAGATTTTCCTTGG - Intergenic
987675504 5:21068090-21068112 CTGTGTATGTCCAGTTTCCTTGG + Intergenic
987801795 5:22707290-22707312 CCGTCTTTGTAAATTTTTCTGGG + Intronic
988312344 5:29576767-29576789 TTGTGTTTTTATATTTTTCTAGG + Intergenic
988671178 5:33383694-33383716 CTGTTTATTCAGATTCTTCTTGG - Intergenic
989468699 5:41789274-41789296 CTATTTTTGTAAATTTTTCTTGG - Intronic
989641038 5:43583477-43583499 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
989998258 5:50861294-50861316 CTGTGTCTGTTGATGTTTCCAGG + Intergenic
990720690 5:58692664-58692686 CTGTGTTTGAGGATTCTTCTTGG + Intronic
990996189 5:61734436-61734458 CTGTGTATTTAGATTTATAAAGG + Intronic
992458425 5:76938188-76938210 CTGTCTATTCAGATTCTTCTTGG + Intergenic
992962472 5:81970104-81970126 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
993715127 5:91268776-91268798 CTGTCTGTTTAGATTTTTCTTGG - Intergenic
994476892 5:100282279-100282301 CTGTATCTGTAGATTGTTTTGGG + Intergenic
994703955 5:103175778-103175800 CTGTGGATCTAGAGTTTTTTGGG + Intronic
994988679 5:106970522-106970544 CTCTGTATCTAGATATTTTTGGG - Intergenic
995083957 5:108086298-108086320 CTGTCTGTTTAGATTTTTCCCGG - Intronic
995397228 5:111699780-111699802 ATGTGTATGTATATGTTTGTGGG + Intronic
995887476 5:116912302-116912324 CTGTGTAAGTATATTTTTCAGGG + Intergenic
996689090 5:126318631-126318653 CTGTCCTTGTAGTTTTTTCTGGG - Intergenic
996929772 5:128871785-128871807 TTGTTTATGTGGATTTGTCTTGG + Intronic
996932937 5:128912505-128912527 CTTTGAATGTAGATTTATTTTGG + Intronic
996936085 5:128950341-128950363 CTGTCTGTCTAGATTTTTCTTGG + Intronic
997362209 5:133302355-133302377 CTGTGGAAGTTGATCTTTCTGGG - Intronic
997787207 5:136724367-136724389 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
998365537 5:141628378-141628400 ATGTGTATGTGCATTTTTCTGGG - Intronic
999116168 5:149165327-149165349 CTTTGTATATAAATTTTTATTGG + Intronic
999268265 5:150280960-150280982 CTGTGTCTGTGCATTGTTCTGGG + Intronic
999568682 5:152894095-152894117 CTATCTATGGTGATTTTTCTTGG + Intergenic
999966713 5:156818340-156818362 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
1003149451 6:3536565-3536587 CTGGTTATGTAGACTTTGCTGGG - Intergenic
1003212858 6:4082630-4082652 CTGTCTCTCTAGATTCTTCTTGG - Intronic
1004327657 6:14690224-14690246 CTGATTATGTAGGTTTTTTTTGG - Intergenic
1004380609 6:15129134-15129156 CTGTCTGTTTAGATTCTTCTTGG - Intergenic
1004558340 6:16721899-16721921 CTGTGTATGTGGGTTTTTCTGGG - Intronic
1004831148 6:19477724-19477746 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
1005569460 6:27130836-27130858 CTGTTTTTTTAGCTTTTTCTCGG - Intronic
1007103904 6:39270169-39270191 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
1007872298 6:45054031-45054053 CTGTTTGTTCAGATTTTTCTTGG - Intronic
1008002076 6:46371060-46371082 GTATGTATGTACATTTTTCGAGG + Intronic
1008033890 6:46726075-46726097 CTGTCTATTCAGATTCTTCTTGG + Intronic
1008280346 6:49588821-49588843 CTGTCCGTCTAGATTTTTCTTGG - Intergenic
1008330990 6:50244243-50244265 GTGTGTGTGTATATATTTCTAGG + Intergenic
1008589745 6:52982176-52982198 CTGTGCATGGAGTTTTTTCCAGG + Intronic
1009042825 6:58200909-58200931 CTGTGTCTGTAGAGTTCTCTTGG + Intergenic
1009218658 6:60955145-60955167 CTGTGTCTGTAGAGTTCTCTTGG + Intergenic
1009251767 6:61310274-61310296 CTGTTTTTGTAGATTCTTCGAGG + Intergenic
1009482128 6:64172157-64172179 TTGTGCATGCATATTTTTCTGGG - Intronic
1009820975 6:68800692-68800714 CTAAGTATTGAGATTTTTCTGGG + Intronic
1009837481 6:69021883-69021905 GTGTGCATGTACATTTTTATAGG + Intronic
1010416107 6:75613449-75613471 TTGTGCATGTATATTTCTCTAGG - Intronic
1011240980 6:85271104-85271126 CTGTGGATGTATAAATTTCTGGG + Intergenic
1011385158 6:86788549-86788571 CTGTTTATTCAGATTCTTCTTGG + Intergenic
1011564069 6:88656618-88656640 CTATGTATGTAAACTTTTCTAGG + Intronic
1011573861 6:88772349-88772371 CTGAATCTGTAGATTGTTCTGGG - Intronic
1012058450 6:94446080-94446102 CTGTGTCAGTTGATGTTTCTGGG - Intergenic
1012218018 6:96612301-96612323 CTGTGATTGCAGATTTTACTTGG - Intronic
1012902493 6:105022518-105022540 CTGTCTGTCTAGATTTTTCTTGG + Intronic
1013381485 6:109576584-109576606 GTGAGTATTTAGAATTTTCTAGG + Intronic
1013501529 6:110756697-110756719 ATGTGTATATATATGTTTCTTGG + Intronic
1014041635 6:116833912-116833934 ATGCGTATATAGATTTTTCTGGG + Intergenic
1014440732 6:121470964-121470986 GTGTGTATATAAATTTTTCCTGG - Intergenic
1015652061 6:135474228-135474250 CTTTTTTTGTAGATTTTTTTGGG + Intronic
1015789545 6:136952518-136952540 CTGTTTGTTTAGATTTTTCTTGG - Intergenic
1016616114 6:146050436-146050458 CTGTGTTTGAAGGTTTTTCAAGG - Intronic
1017160307 6:151359637-151359659 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
1018269713 6:162063914-162063936 GTGTGTATTTTCATTTTTCTTGG - Intronic
1019168884 6:170117503-170117525 CTGTGTCTGTGGCTGTTTCTAGG - Intergenic
1019600123 7:1877644-1877666 CTGTGTCTGTATATTTTTAATGG - Intronic
1019759793 7:2802373-2802395 CTGGGGATGTAGATTTTTTTTGG + Intronic
1020551311 7:9608721-9608743 GTGTGTCTCCAGATTTTTCTGGG + Intergenic
1020714883 7:11660144-11660166 ATGAGTTTGTAAATTTTTCTAGG - Intronic
1022109070 7:27216936-27216958 CAGTGTCTGGAGACTTTTCTGGG - Intergenic
1022588474 7:31638459-31638481 TTATGTTTGTAGACTTTTCTAGG + Intronic
1023609770 7:41960939-41960961 CTTTGTATGGAAATTTTTATTGG - Exonic
1024385084 7:48741813-48741835 CTGTGTGAGTGGATTTTTGTTGG + Intergenic
1027332417 7:77112582-77112604 TTTTGTATGTAGATTATTGTTGG - Intergenic
1027773772 7:82441002-82441024 TTCTGTATGTAAATTTCTCTCGG - Intronic
1027928153 7:84494824-84494846 CTGTTTATTTATTTTTTTCTTGG - Intergenic
1027929059 7:84507619-84507641 CTGCGAGTATAGATTTTTCTGGG - Intergenic
1028000699 7:85494544-85494566 CTGTGTATCTTCATTCTTCTTGG - Intergenic
1028230806 7:88304562-88304584 CTTTGTAGCTAGTTTTTTCTGGG - Intronic
1028755996 7:94434931-94434953 GTGGGTATGTGCATTTTTCTTGG + Intergenic
1029783365 7:102758746-102758768 TTTTGTATGTAGATTATTGTTGG + Intronic
1030515893 7:110537294-110537316 CTGTGTTAGTAGGTTTATCTTGG + Intergenic
1030602006 7:111603217-111603239 CTGTCTGTTTAGATTCTTCTTGG - Intergenic
1030721991 7:112881803-112881825 CTGTCTGTGTACATTTTTCCTGG + Intronic
1031176534 7:118359496-118359518 CTATCTGTCTAGATTTTTCTTGG + Intergenic
1031196406 7:118619958-118619980 GTTTATATGTAGATTCTTCTGGG + Intergenic
1031464272 7:122089250-122089272 CTGTGTCTTAAGAATTTTCTAGG - Intronic
1031490392 7:122380741-122380763 ATGTGAATGTGGAATTTTCTGGG + Intronic
1032025731 7:128440748-128440770 CTGTTTTTGTAGAATCTTCTAGG + Intergenic
1032441330 7:131945155-131945177 CAGTGTCTGGAGATTTTACTCGG - Intergenic
1032470397 7:132174485-132174507 GTGCATATGTAGTTTTTTCTGGG + Intronic
1033127837 7:138720569-138720591 CTCTGTACCTAGAATTTTCTTGG + Intronic
1033400008 7:141013996-141014018 GTGTGTGTGTAAATTGTTCTGGG + Intronic
1033533743 7:142292601-142292623 CTCTGAAGGAAGATTTTTCTGGG - Intergenic
1033803655 7:144929922-144929944 CTGTGTATGAAGAATTTCCATGG + Intergenic
1034599026 7:152230321-152230343 CTGTGTATTTTGCTTTTTATAGG - Exonic
1035881394 8:3247222-3247244 CTGTGAATGTACATTTGTCAAGG - Intronic
1035892918 8:3365283-3365305 CTGACTTTGTTGATTTTTCTTGG - Intronic
1036392737 8:8338511-8338533 CTTTTTCTGTAGATTTTTCTAGG - Intronic
1036982027 8:13480628-13480650 CTGTGTATCTTAATTTTTGTTGG - Intronic
1037033214 8:14135670-14135692 CTGTGTTTGAAGACTTTTTTTGG - Intronic
1037095780 8:14984923-14984945 CTTTTTTTGTGGATTTTTCTGGG + Intronic
1037186965 8:16076320-16076342 ATGTGTATGTATATTTTTATTGG + Intergenic
1037281835 8:17249980-17250002 CTGTTTGTTCAGATTTTTCTTGG + Intronic
1037790598 8:21936799-21936821 CTTTATAGGTAGAATTTTCTGGG + Intronic
1038316114 8:26485692-26485714 CTGGGTGTGTGGATGTTTCTAGG + Intronic
1038404876 8:27314093-27314115 CTGTCTGTCTAGATTTTTCTTGG - Intronic
1038417576 8:27408367-27408389 CTGTCTGTCTAGATTCTTCTGGG - Intronic
1038553139 8:28486939-28486961 GCGTGTATGTGCATTTTTCTAGG - Intronic
1038897556 8:31802956-31802978 CTGTCTTTGTTGATTTTTGTGGG + Intronic
1039304745 8:36249375-36249397 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
1039328340 8:36509504-36509526 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
1039333679 8:36566844-36566866 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
1039366930 8:36938198-36938220 ATGCATATGTAAATTTTTCTGGG - Intergenic
1039620194 8:38989907-38989929 CTGTGTATGTAGATTTTTCTGGG + Exonic
1039771821 8:40694993-40695015 CTGTCTGTCTAGATTCTTCTTGG - Intronic
1041346065 8:56899263-56899285 AAGTGGATATAGATTTTTCTTGG - Intergenic
1043047507 8:75345440-75345462 GTGCAAATGTAGATTTTTCTAGG + Intergenic
1043682436 8:83045594-83045616 CTGTGTATTCAGATTCTTCTTGG + Intergenic
1044446459 8:92282574-92282596 GTGTGTAAGTAAAATTTTCTTGG + Intergenic
1044777704 8:95709758-95709780 CTCTGTATCTAGATTATTCTTGG + Intergenic
1045143939 8:99317664-99317686 ATGTGTATGTGGATTTACCTTGG + Intronic
1045292931 8:100849261-100849283 GTGTGCATGTACAATTTTCTGGG - Intergenic
1045847557 8:106656628-106656650 CTGGGTATGCAGATTCTCCTGGG + Intronic
1046098976 8:109593032-109593054 CTGTGCATGAAGATTTATCTGGG + Intronic
1046943481 8:119953681-119953703 CCGTCTATCTAGATTCTTCTTGG + Intronic
1051220171 9:14840296-14840318 CTATGTACGTACATTTTGCTAGG - Intronic
1051375247 9:16395769-16395791 ATGTGTAAGTACATTTTCCTTGG - Intergenic
1051512809 9:17898066-17898088 CTGTAGCTGTAGATTTTTATTGG + Intergenic
1051692704 9:19733217-19733239 CTCTGGATTTAGAATTTTCTTGG + Intronic
1051815114 9:21095777-21095799 CTGTCTGTCTAGATTCTTCTGGG - Intergenic
1051816962 9:21120033-21120055 CTGTCTGTCTAGATTCTTCTGGG + Intergenic
1051876259 9:21796976-21796998 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
1052256698 9:26465683-26465705 CGGTGTATGTAGTCCTTTCTTGG + Intergenic
1052361222 9:27561472-27561494 CTGTCTACTTAGATTGTTCTAGG - Intronic
1052745403 9:32435406-32435428 GTGGGTATGTGCATTTTTCTGGG - Intronic
1053084451 9:35206346-35206368 ATGTGTATGGGTATTTTTCTTGG - Intronic
1054716370 9:68560909-68560931 CTTTGTATGGATTTTTTTCTTGG + Intergenic
1055057943 9:72040609-72040631 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
1055250185 9:74294217-74294239 CTGTCTGTTTAGATTCTTCTTGG + Intergenic
1055292411 9:74796127-74796149 CTATGTTTTTAGAATTTTCTAGG - Intronic
1055519316 9:77064508-77064530 CTCTTTATTAAGATTTTTCTGGG + Intergenic
1055799812 9:80022720-80022742 CTGTGTGTTCAGATTCTTCTTGG - Intergenic
1055868322 9:80842676-80842698 GTGTGTATTTAGCTTTATCTTGG + Intergenic
1056263399 9:84872187-84872209 CTGAGTTTGTAAATTTTACTGGG - Intronic
1057021110 9:91698204-91698226 CTGTGTGTTCAGATTCTTCTTGG - Intronic
1057212313 9:93206813-93206835 TCGTGTTTGTAGGTTTTTCTGGG + Intronic
1057288680 9:93784018-93784040 CTGAATATGTAGATTTCTTTGGG + Intergenic
1057318721 9:93991928-93991950 CTATCTGTCTAGATTTTTCTTGG + Intergenic
1058627336 9:106948575-106948597 CTGTGAATAGAGATTATTCTGGG - Intronic
1059908452 9:119015566-119015588 TTGTCTATGTACATTTTTGTTGG - Intergenic
1060116587 9:120946190-120946212 GTGTGTATGTGCATGTTTCTGGG + Intergenic
1060754611 9:126203611-126203633 CTGGGTGTGTGGATTGTTCTGGG + Intergenic
1061333288 9:129911356-129911378 CTGTCTGTGCAGATTCTTCTTGG - Intronic
1061812277 9:133169251-133169273 CTGTCTGTGCAGATTCTTCTTGG + Intergenic
1185588401 X:1257492-1257514 CTGTCTTTCTAGATTCTTCTTGG - Intergenic
1185771070 X:2766114-2766136 CTGTGTGTCTAGATTCTTCTTGG + Intronic
1185988492 X:4864388-4864410 GTGTGTATATACATATTTCTAGG - Intergenic
1186039542 X:5460888-5460910 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
1186134595 X:6505782-6505804 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
1186180412 X:6967943-6967965 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
1186185387 X:7015368-7015390 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
1186213378 X:7273562-7273584 CTGTCTGTCTAGATTGTTCTTGG - Intronic
1186218573 X:7325836-7325858 CTGTCTATCTAGATGCTTCTTGG + Intronic
1186428575 X:9485110-9485132 CTCTGTGTGTTGGTTTTTCTGGG - Intronic
1186491054 X:9972665-9972687 GTGTGTATGGACATTCTTCTGGG - Intergenic
1186568039 X:10685586-10685608 CTGTCTGTCTAGATTCTTCTTGG - Intronic
1186629258 X:11331254-11331276 CTGTCCATCTAGATTATTCTTGG - Intronic
1186829896 X:13379692-13379714 CTGTCTGTCTAGATTCTTCTTGG + Intergenic
1187085510 X:16038884-16038906 CTGTTTGTTCAGATTTTTCTTGG - Intergenic
1187325471 X:18282658-18282680 TTGTGTGTGTAGAGTTTTGTTGG - Intronic
1187842336 X:23501669-23501691 CTGTCTGTCTAGATTTTTCTTGG - Intergenic
1188995183 X:36876075-36876097 CTGTGTCTGTAGATCCTTTTGGG - Intergenic
1189076429 X:37920340-37920362 CTGTGGAGGTAGATTTTCCATGG - Intronic
1189606866 X:42687576-42687598 CTATTTAAATAGATTTTTCTAGG - Intergenic
1189679648 X:43502331-43502353 GTGTGTGTGTAGACTTTTTTTGG - Intergenic
1189724046 X:43950860-43950882 GTGCTTATGTACATTTTTCTGGG - Intronic
1189999881 X:46675777-46675799 CTGTGTGTTCAGATTCTTCTTGG - Intronic
1190154406 X:47976328-47976350 CAGTGAATGTTGACTTTTCTCGG + Exonic
1190517586 X:51240802-51240824 CTGAGTGTGTAGATTTCTTTGGG - Intergenic
1190550139 X:51571236-51571258 CTGTCTGTCTAGATTCTTCTTGG - Intergenic
1192609120 X:72550088-72550110 TTGTGTATGTAGATTTTCTAGGG + Intronic
1192867521 X:75151065-75151087 ATACGTATGTATATTTTTCTAGG + Intronic
1193490218 X:82140528-82140550 CTGAATATGTAGATTTATTTGGG - Intergenic
1193545028 X:82816061-82816083 GTCTGTATGGACATTTTTCTAGG + Intergenic
1193917430 X:87382555-87382577 CTGTGTATGTGTATCTTTATAGG - Intergenic
1194579246 X:95651238-95651260 TTCTGTATGTAAATTTTTCATGG - Intergenic
1194614438 X:96083915-96083937 CTCAGTATGTTGGTTTTTCTGGG + Intergenic
1194618694 X:96140169-96140191 TAGTGTTTGCAGATTTTTCTGGG - Intergenic
1194687655 X:96943126-96943148 CTCTGTATGCTGATTTTTCTTGG + Intronic
1195433604 X:104817140-104817162 CTGTCTGTCTAGATTCTTCTTGG + Intronic
1195474805 X:105273576-105273598 CTGTCTGTCTAGATTCTTCTGGG - Intronic
1195675048 X:107501695-107501717 GTGCGTATGTACACTTTTCTGGG + Intergenic
1196224097 X:113145466-113145488 CCGTGTATGTTGAGTTTTCGAGG + Intergenic
1196256130 X:113521384-113521406 CTGTCTGTCTAGACTTTTCTTGG - Intergenic
1196367972 X:114944365-114944387 CTGTTTATTTAGCTTCTTCTTGG + Intergenic
1196465156 X:115964589-115964611 CCTTGTATGTTGATTTTGCTGGG - Intergenic
1196915620 X:120531970-120531992 TTGTGGAAGTAGATTTTTTTGGG - Intronic
1196972462 X:121124474-121124496 CTGTGTTTGTTGATGTTTCCAGG + Intergenic
1197231861 X:124014004-124014026 CTGAGTATGTAGGTTTGTCAAGG + Intronic
1197379372 X:125721102-125721124 CAGTGTATGTGCATTTTTATAGG + Intergenic
1197564515 X:128065491-128065513 CTGAGTTTGTAGATTTCTTTGGG - Intergenic
1197604877 X:128573994-128574016 CTGTATTTGGAGATTTTTCACGG + Intergenic
1198226469 X:134650046-134650068 CTGTCTGTTTAGATTCTTCTTGG - Intronic
1198302690 X:135346819-135346841 ATGTGTATGTGTATTTTTCTAGG + Intronic
1199073100 X:143501483-143501505 CTGTATGTCTAGATTATTCTTGG + Intergenic
1199215626 X:145257276-145257298 CTGTATGTCTAGATTATTCTTGG - Intergenic
1199876692 X:151936438-151936460 CTCTATATGTAGAGTTTCCTAGG + Intergenic
1201235983 Y:11912295-11912317 CTGCCTATGTATATTTTTCCAGG - Intergenic
1201299316 Y:12492065-12492087 CTGTGTGTCTAGATTCTTCTTGG - Intergenic
1201374480 Y:13301782-13301804 CTGTGTATTTGGAGTTTCCTAGG + Intronic
1201638856 Y:16157159-16157181 TTTAGTTTGTAGATTTTTCTGGG - Intergenic