ID: 1039623684

View in Genome Browser
Species Human (GRCh38)
Location 8:39025400-39025422
Sequence CAGGGTGAACATGAGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039623684 Original CRISPR CAGGGTGAACATGAGGAGTA AGG (reversed) Intronic
900650315 1:3727191-3727213 CAGGGTGATGATGATGAGGATGG - Exonic
900947864 1:5841305-5841327 CAGGATGAACATGAGGGCTGTGG - Intergenic
901242005 1:7700575-7700597 CTGTGTGACCATGATGAGTAGGG - Intronic
902773754 1:18661236-18661258 AAGGGTTGCCATGAGGAGTAGGG + Intronic
904460208 1:30672563-30672585 CAGGGTGAAAATGAGGCATGGGG - Intergenic
904467213 1:30715314-30715336 CAGGAGGAACAGGAGAAGTAAGG + Intronic
905871595 1:41407535-41407557 CAGGGTGAACATGAGAAGGATGG - Intergenic
905907848 1:41631488-41631510 CAGGGTGCCCAAGAGGAGAAAGG - Intronic
905966171 1:42098077-42098099 CAGTGTGAACATGTGGTGTTTGG - Intergenic
906140218 1:43530005-43530027 GAGGGTGAACATGAGGATGAAGG + Intronic
907327309 1:53647269-53647291 CAGGGTGATCCTGAAGAATAAGG + Intronic
907684850 1:56600555-56600577 AAGGGTGGACATGAGAAGTTTGG + Intronic
909045159 1:70700796-70700818 CAGCGTGGACATTAGGATTAAGG + Intergenic
910161689 1:84278896-84278918 CAGAGGGAATATGAGGAGAAAGG + Intergenic
910474111 1:87588643-87588665 CTGGGTGACCATGAGAAGCATGG + Intergenic
910499595 1:87874818-87874840 GAGTGGGAACATGAGGAATACGG - Intergenic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
912703254 1:111894186-111894208 CAGAGTGAACAAGTGGGGTAAGG - Intronic
913484309 1:119319880-119319902 AAGGGTGAAGGTGAGGACTAGGG - Intergenic
914948325 1:152086612-152086634 TTGGGTGAACCTGAGGATTATGG - Exonic
915118760 1:153615775-153615797 CAGGGTGAAGGAGAGGAGTGTGG + Intronic
915158525 1:153898963-153898985 CAGGGGCAACTTCAGGAGTAAGG - Intronic
917001712 1:170367930-170367952 CAAGGAGAACAAGAGGAGGATGG - Intergenic
917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG + Intronic
920750130 1:208666473-208666495 TAGAGTGAATCTGAGGAGTATGG - Intergenic
921035475 1:211374280-211374302 CAGCGTGCATATGAGCAGTAGGG - Exonic
924276453 1:242392377-242392399 CAGGGTGAACATGTGCAGGTTGG - Intronic
1063127820 10:3150887-3150909 CAGGGTAAACATTAGGAAAAAGG + Intronic
1064881946 10:20065330-20065352 CATGGTGAACATGAGTTCTAGGG - Intronic
1065930413 10:30473886-30473908 CAGGGTGAGTAGGATGAGTAGGG + Intergenic
1066997630 10:42578360-42578382 GAGGATGAAGAGGAGGAGTAGGG - Intronic
1070009256 10:72456302-72456324 AAGAGTGAATATTAGGAGTAGGG - Intronic
1071877761 10:89861320-89861342 GAGGGGGAAGAGGAGGAGTAGGG - Intergenic
1074530876 10:114297837-114297859 CAGGGTTAACAGGAGGAGCCAGG - Intronic
1076988029 11:253405-253427 CAGAGTGAACATTAGGTGGAAGG + Intergenic
1077016003 11:399438-399460 GAGGGAGGACAGGAGGAGTAGGG - Intronic
1078123595 11:8536095-8536117 AAGGGTGAACGTGGGGAGGAGGG + Intronic
1078279887 11:9890795-9890817 CAGGGTGACCCTGAGGTGCATGG + Intronic
1080606347 11:33868503-33868525 CAGCGTTAACATGGGGAGTAAGG - Intronic
1081460002 11:43263791-43263813 CAGGGAGAAGCTGAGGAGGATGG - Intergenic
1082008705 11:47436175-47436197 GGGGGTGAACATGAGGAAGAGGG + Intergenic
1083780498 11:64915050-64915072 CAGGGTGAACATGGGTATTCTGG - Intronic
1086370169 11:86148437-86148459 CAGGGAGAATAAGAGGAGTAGGG + Intergenic
1089297219 11:117477014-117477036 CAGGGTGGCCATGAGGATTTGGG - Intronic
1089697670 11:120225952-120225974 CAGCGTGAAGATGAGGAGCTGGG - Intronic
1090355945 11:126140437-126140459 CTGGGTGGAAAGGAGGAGTAAGG + Intergenic
1090593476 11:128295803-128295825 CTGGCTGAAGATGAGGAGTGAGG + Intergenic
1090828125 11:130402162-130402184 CGGGGTGAACATCATGAGGACGG - Intergenic
1091386660 12:100345-100367 AATGGTGAGCATGAGGAGTCCGG - Intronic
1091628356 12:2139810-2139832 CAGTGTGAACTGGAGGTGTAAGG + Intronic
1094348323 12:29496633-29496655 CATGGTCAACATGAAAAGTAAGG - Exonic
1095404174 12:41849442-41849464 GAAGATGAGCATGAGGAGTAGGG - Intergenic
1095996618 12:48092153-48092175 CAGGATGAAAATGAGCAGCAAGG - Intronic
1097918676 12:65047527-65047549 CAAGCTGAACATGAGGAGGGAGG + Intergenic
1099108430 12:78524823-78524845 CAGTGAGAACATGAGGTGTTTGG - Intergenic
1102084114 12:110122336-110122358 TAGGGTTGACATGAGGATTAAGG - Intergenic
1106158831 13:27182894-27182916 CAGGGTGGACATGTGGACTGTGG - Intergenic
1108395938 13:49991712-49991734 CAGGGTGGAGATGAGGAGCATGG - Intergenic
1108583381 13:51846192-51846214 CAGGGTGAAGCAGAGGAGCAAGG + Intergenic
1108837293 13:54567493-54567515 CAGGGTGAGAATGGAGAGTATGG + Intergenic
1110228403 13:73143600-73143622 ATGGGTGAACAAGAGGAGGAAGG - Intergenic
1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG + Intronic
1112639663 13:101258536-101258558 CAGGATGAACATGTGGAAAACGG + Exonic
1113394457 13:109933719-109933741 CAGGGTGAAGAGGAGGAGTGTGG - Intergenic
1116817720 14:49599154-49599176 CAGGGTGGAGATGAGCAGGAAGG - Exonic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117740330 14:58812134-58812156 CAGTGTGAAAATGATGAGTTAGG - Intergenic
1118317072 14:64731949-64731971 CAGGGTCAAAGTGAGGAGTCAGG + Intronic
1119796711 14:77404722-77404744 CAGGAAGAAAATGAGGAGAACGG + Intronic
1120389957 14:83893838-83893860 CAGGGTGACCTTGAAGAGAATGG - Intergenic
1124067121 15:26354794-26354816 CAGGGTGAAGTTGTGGAGTCTGG - Intergenic
1124240604 15:28024753-28024775 CAGGGGGAACCTGAGGTGTGGGG - Intronic
1127635950 15:60869822-60869844 CAGAGGGAACAAGAGGAGGATGG - Intronic
1128944689 15:71812386-71812408 CAGGGGGAGGAAGAGGAGTATGG - Exonic
1130298663 15:82664382-82664404 CAGGATGAGGATGAGGAGAAAGG - Exonic
1130372747 15:83299975-83299997 AAGGGTGAACATCAGGAGGAAGG + Intergenic
1132710312 16:1263417-1263439 CAGGGTGACCATGAGGATAGGGG + Intergenic
1134230470 16:12425221-12425243 CAGGGTGAAAGTGAGGGGTCAGG + Intronic
1134622429 16:15699629-15699651 AAGGGTGAACATCAAGAGTCAGG - Intronic
1137629446 16:49931958-49931980 CAGGGTGAAAATGACCAGCATGG + Intergenic
1137801283 16:51264270-51264292 AAGAGTGAACATGAGGATAATGG - Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139958387 16:70704170-70704192 CAGGGTGGGCAGGAGGAGTAAGG + Intronic
1143408557 17:6694799-6694821 CAGGGTGACCATGAAGACTTTGG + Intronic
1145935594 17:28712905-28712927 CAGGATGAAGAGGAGGAGAAAGG + Intergenic
1148392073 17:47279937-47279959 CAGGGACAACAGGAGGAGTCTGG + Intronic
1148894572 17:50832469-50832491 CAGGGTGAACCTGAGGTCAAGGG + Intergenic
1149180096 17:53925977-53925999 AAGGCAGAAAATGAGGAGTAAGG - Intergenic
1150630087 17:66874199-66874221 CAGGATTAAAATGGGGAGTAAGG + Intronic
1152495217 17:80666397-80666419 CAGGGTGACCCTGAAGAGTTAGG + Intronic
1154077241 18:11215416-11215438 CAGAGTGATCATGAGGGGTTGGG + Intergenic
1155070087 18:22307391-22307413 TGGCTTGAACATGAGGAGTAGGG + Intergenic
1155529959 18:26756932-26756954 CAAGGTGAACATGAGCTGTTAGG + Intergenic
1158631422 18:59118407-59118429 CAGTGAGAACATGCGGAGTTTGG - Intergenic
1159840938 18:73398496-73398518 CAGCGTGAAGATGATGAGGATGG - Intergenic
1161233925 19:3188790-3188812 CAGGGCGCAGATGAGGAGCATGG - Intronic
1164416346 19:28049201-28049223 TAGGCTGAACCTGAGGAGGATGG + Intergenic
1164455611 19:28404134-28404156 CAGGGTGTACATGGGGAGGCTGG + Intergenic
1164821732 19:31256081-31256103 GAGGGTGAACATGGGGACCAAGG - Intergenic
1164965010 19:32475386-32475408 CAGAGAGAACATGATGAGTCTGG - Intronic
1165355028 19:35299370-35299392 CGGGGTGACCAAGAGGAGGAAGG + Intronic
1165952651 19:39482849-39482871 CAGGATGAATATGAGGAATTAGG - Intronic
1166373574 19:42315209-42315231 GAGGATGAAGATGAGGAGGAAGG - Exonic
1168191216 19:54739987-54740009 CAGGGTAGACATGAGGTGGAGGG - Intronic
925530205 2:4850917-4850939 CAGGGAGAACCTGAAAAGTACGG - Intergenic
925914153 2:8592878-8592900 CAGGGAGGCCATGAGGAGTGCGG - Intergenic
927293955 2:21431990-21432012 CAGGGAGAACAGAAGCAGTAAGG + Intergenic
927862709 2:26570190-26570212 CAGGGAGCAGAGGAGGAGTATGG + Intronic
928111749 2:28516280-28516302 CTTGCTGAACGTGAGGAGTAAGG - Intronic
928622661 2:33106935-33106957 AAGGGTGAAAATGAGAAGTAGGG - Intronic
929532384 2:42761276-42761298 CAGGGTCAAGATGGGGAGCAAGG + Intergenic
929968256 2:46551522-46551544 CAGTGTCAACATGTGGAGCAGGG + Intronic
931712072 2:64996861-64996883 CTGTGTGAACATGAGGAGTTGGG + Intronic
932169120 2:69537702-69537724 CAGGGTGAACAGGAGCACTTGGG + Intronic
935171628 2:100614814-100614836 CGGGATGAGCATGAGGACTAGGG + Intergenic
938679064 2:133670802-133670824 CAGAGTGAAAATCAGGAGTTAGG + Intergenic
939433431 2:142141453-142141475 CATGGTGGACAAGAGGAGGAAGG + Intergenic
940656494 2:156493333-156493355 TAGGGTGAGTGTGAGGAGTAAGG + Intronic
940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG + Intergenic
942739530 2:179158989-179159011 GAGGGTGAAGGTGAGGAGAAAGG + Intronic
943585553 2:189735138-189735160 AAGGGTGCACATGAGGAGTAAGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG + Intronic
946479998 2:220045914-220045936 CAGGGTGAAAATAAGGGGCATGG + Intergenic
946831891 2:223735853-223735875 AAGTTTGAACATGAGGAGGAGGG - Intergenic
948737422 2:240017998-240018020 CAGGCTGACCTTGAGGAGTCAGG - Intronic
1168840543 20:907310-907332 CAAGGAGAAGATGAGGAGTGTGG + Intronic
1170878530 20:20273681-20273703 CAGGGATAACATGATGGGTAGGG + Intronic
1172609517 20:36239688-36239710 CAGGGTTGTCATGAGGATTAAGG + Intronic
1172858093 20:38023911-38023933 CAGGAAGAACATGCGGAGGAGGG + Intronic
1173809108 20:45945662-45945684 CAGCGTGAGAATGAGGAGTGTGG + Intronic
1174094961 20:48081010-48081032 CAGGCTGAGGATGAGGAGAAGGG + Intergenic
1174740377 20:53007419-53007441 AAGAGTTAACAAGAGGAGTATGG + Intronic
1175840042 20:62020931-62020953 CAGCGTGAACATGAGGAAGGAGG + Intronic
1178053019 21:28768553-28768575 TAGGCTGAACATGAGGAGAAGGG - Intergenic
1179714907 21:43281619-43281641 CAGGATGAACATCGGGAGGAGGG - Intergenic
1181711313 22:24693042-24693064 CAAGGTAAACATGAAAAGTAAGG + Intergenic
949720679 3:6986509-6986531 CAGAGTGAACATTAGAAGTTAGG - Intronic
950679964 3:14578371-14578393 CAGGGTTGTCATGAGGACTAAGG + Intergenic
951948606 3:28172137-28172159 CAGGTTGTACATGAGCTGTACGG - Intergenic
953031189 3:39180947-39180969 CAAGGTGACGATGAGGACTAAGG - Intergenic
955162486 3:56478153-56478175 CAGGGTGAACCTGAGGGCTGTGG - Intergenic
956398812 3:68854278-68854300 CAAGGTGAACAAGAAGAGAATGG + Intronic
956935571 3:74096946-74096968 CAGGATGAAAAGGAAGAGTAAGG + Intergenic
960883397 3:122369415-122369437 CAGGGTGAACATGAGCAACTTGG + Intronic
962731823 3:138290426-138290448 CAAGGGGTACAGGAGGAGTAGGG + Intronic
964734537 3:159903152-159903174 CTGGCTGAACATGAGGACTGAGG + Intergenic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
969577746 4:8046410-8046432 CAGGGTGAATAGGAGGCGTGGGG - Intronic
969829342 4:9782172-9782194 CAGGGTCCAGATGATGAGTAGGG - Exonic
971612420 4:28742733-28742755 GAGGGTGAAGATGGGGAGAAAGG + Intergenic
972077173 4:35103158-35103180 CAGGATGACAATAAGGAGTAAGG + Intergenic
974146141 4:57949812-57949834 CAGGGTTAAGATTATGAGTATGG - Intergenic
977837085 4:101657669-101657691 GAGGATGAACATGGGGAGAAGGG - Intronic
980193965 4:129564108-129564130 CAGGGAGAACATGGTCAGTATGG - Intergenic
980507491 4:133741436-133741458 CAGGGTGAAGGTTAGGAGGAGGG - Intergenic
982672625 4:158339895-158339917 AAGGGTTAACATTAGGATTAAGG + Intronic
983568603 4:169180550-169180572 CAGAGTAAACAAGGGGAGTATGG + Intronic
985619148 5:944572-944594 CATGGGGAACAAGAGGAGTATGG - Intergenic
985626545 5:991860-991882 CAGGATGGAGATGAGGTGTACGG - Intergenic
988349675 5:30086037-30086059 CCAGGTGATCATGAGGGGTAGGG - Intergenic
990148662 5:52790889-52790911 CAAAATGAACATGAGGATTATGG - Intronic
991106062 5:62843296-62843318 CATGTAGAACATTAGGAGTAGGG + Intergenic
992241242 5:74772097-74772119 CAGGTTGAACACTAGGATTATGG - Intronic
993060499 5:83032898-83032920 CAGGGCAAACTTAAGGAGTAGGG - Intergenic
995953538 5:117746477-117746499 CAGCATGTACTTGAGGAGTAAGG - Intergenic
996314591 5:122147607-122147629 GAGTGTGAACATGAGGTGTTCGG + Intronic
1000248164 5:159467598-159467620 CAGGGTGAACCTGTTGAATAAGG + Intergenic
1000740191 5:164959688-164959710 CAGGTAGAAACTGAGGAGTATGG + Intergenic
1001721404 5:173859986-173860008 CAGGGAGAACAAGAAGGGTAAGG + Intergenic
1001982935 5:176048586-176048608 CAGGGTGAACATTAGGCTTCTGG - Intergenic
1002234528 5:177795470-177795492 CAGGGTGAACATTAGGCTTCTGG + Intergenic
1006382582 6:33708509-33708531 CAGGGTGATCATTAGGACGAAGG + Intronic
1008038444 6:46772183-46772205 CAGTTTGAACTTGAGGAGTTTGG + Intergenic
1008319012 6:50083726-50083748 CAGGGTTAACATGAGAAGTCAGG + Intergenic
1010139128 6:72593020-72593042 GAGTGAGAACATGAGGTGTATGG + Intergenic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1010919199 6:81660668-81660690 CATGATGAAAATGAGGACTAGGG - Intronic
1011772093 6:90684755-90684777 CAGGCTGAACATGAAGAGAAAGG - Intergenic
1013507219 6:110813364-110813386 CAAAGTTAGCATGAGGAGTATGG + Intronic
1015729406 6:136333039-136333061 CATGGGGAACAAGAGGAGCAGGG + Intergenic
1016995112 6:149956125-149956147 CATGGTGAACATGGAGAGTCGGG + Intergenic
1017003500 6:150013310-150013332 CATGGTGAACATGGAGAGTCGGG - Intergenic
1017969518 6:159299548-159299570 CTGGGTGAAGAAGAGGAGGAAGG + Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019903307 7:4041585-4041607 AGGGGTGAACAGGAGGAGCATGG - Intronic
1020625682 7:10576299-10576321 CTGGGGGAACATGAGGTATAGGG + Intergenic
1021370441 7:19838628-19838650 CAGGTTGAAAATGAGGTGTTAGG - Intergenic
1025035880 7:55592260-55592282 CAGGGTACACATGGGGAGTGTGG + Intergenic
1026095521 7:67343417-67343439 CATGCTGAGCATGAGGAGTGAGG - Intergenic
1028688850 7:93626618-93626640 CAGGGTGTGCATGAGGGGTATGG + Intronic
1031534566 7:122917235-122917257 CAGGGTTAAGATAAGGGGTATGG - Intergenic
1032433127 7:131879214-131879236 CAGGGCAGCCATGAGGAGTAAGG + Intergenic
1032558573 7:132863809-132863831 CAGGTTGATCATGAGGTTTATGG - Intronic
1032859822 7:135866319-135866341 CATGGTGATGATGAGGAGGAGGG - Intergenic
1033597172 7:142866374-142866396 CAGGCTGGAGATCAGGAGTAGGG - Intronic
1035529321 8:338345-338367 CTGTGAAAACATGAGGAGTAGGG + Intergenic
1037231353 8:16662534-16662556 GATGGTGAATATGAAGAGTATGG - Intergenic
1038858951 8:31364646-31364668 CAGTGAGAACATGAGGTGTTTGG + Intergenic
1039623684 8:39025400-39025422 CAGGGTGAACATGAGGAGTAAGG - Intronic
1041837145 8:62229344-62229366 GAGGGAGAACATGCGGAGTTTGG - Intergenic
1045417316 8:101980206-101980228 CAGGGAGAAGATGGGGAGTGGGG - Intronic
1046331237 8:112717820-112717842 CAGTGAGAACATGAGGTGTTTGG - Intronic
1047090677 8:121572244-121572266 AAGGGTAAACATGATGACTATGG - Intergenic
1047555204 8:125921751-125921773 CAGCCAGCACATGAGGAGTAGGG - Intergenic
1048163692 8:132043286-132043308 CAGGGTTAACAGGAGGCCTATGG - Intronic
1049604901 8:143524751-143524773 CCGGGGGAACAAGAGGAATAGGG + Intronic
1050005555 9:1125920-1125942 CAGGGTGAACTTGAAAAGAAAGG - Intergenic
1050421074 9:5465760-5465782 CTGGGTGAAGATGAAGCGTAAGG + Intronic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1051160285 9:14199966-14199988 CAGGGAGAACAGGAGCAGAAGGG + Intronic
1053167058 9:35852483-35852505 CATGGTGAGCATGAGGAGACAGG + Intronic
1054821837 9:69530473-69530495 AAGTGAGAACATGAGGAGTTTGG - Intronic
1062343416 9:136103836-136103858 CAGGGTGGACAGGTGGAGTGTGG - Intergenic
1188056799 X:25550648-25550670 CTGGGTGAACTTGGGGACTAGGG + Intergenic
1189253530 X:39619954-39619976 CAGAGGGAACAAGGGGAGTAGGG + Intergenic
1189256321 X:39642504-39642526 CAGGATGAGGAGGAGGAGTAGGG + Intergenic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1190289229 X:48981325-48981347 CAGGGGTAACATGAGGACTGAGG + Intronic
1195000809 X:100641634-100641656 CAGGGTGAAGATGCTGCGTAAGG - Intergenic
1195385484 X:104310028-104310050 CAGAGTGAACCTGGGAAGTAGGG - Intergenic
1195532033 X:105968529-105968551 CAGGGTGCACAAGTGTAGTAAGG + Intergenic
1196350836 X:114726936-114726958 CATGGTGAACCTGAGGAATGCGG + Exonic
1196465503 X:115968549-115968571 CGGGGCGAACAGGAGGAGAAGGG - Intergenic
1196942868 X:120794833-120794855 CAGGGTGAACAATAAGAATAAGG - Intergenic
1197387965 X:125824162-125824184 CTGGGTGAACATCAGAATTAAGG - Intergenic
1197659488 X:129154770-129154792 CAGGGTGAAAAAGATGAGCAGGG + Intergenic