ID: 1039624801

View in Genome Browser
Species Human (GRCh38)
Location 8:39037929-39037951
Sequence ATTCACATGGGGAAGACTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039624801_1039624811 22 Left 1039624801 8:39037929-39037951 CCCATAGTCTTCCCCATGTGAAT 0: 1
1: 0
2: 1
3: 15
4: 171
Right 1039624811 8:39037974-39037996 GTATCCCAGGACAACAACCTGGG No data
1039624801_1039624807 9 Left 1039624801 8:39037929-39037951 CCCATAGTCTTCCCCATGTGAAT 0: 1
1: 0
2: 1
3: 15
4: 171
Right 1039624807 8:39037961-39037983 CTCCTTCCTTCTAGTATCCCAGG No data
1039624801_1039624810 21 Left 1039624801 8:39037929-39037951 CCCATAGTCTTCCCCATGTGAAT 0: 1
1: 0
2: 1
3: 15
4: 171
Right 1039624810 8:39037973-39037995 AGTATCCCAGGACAACAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039624801 Original CRISPR ATTCACATGGGGAAGACTAT GGG (reversed) Intronic
902241906 1:15095142-15095164 AGACACATGGGGAAGACAAGAGG + Intronic
902897492 1:19488971-19488993 ATTGATCTGGGGAAGACTGTAGG + Intergenic
905288153 1:36899774-36899796 ATTCAGATGGAGAAGACTTTGGG + Intronic
906165348 1:43681899-43681921 ATTTACATGGTTAAGACTGTCGG + Intronic
906566700 1:46806018-46806040 AGACCCATGGGGAAGGCTATGGG + Intronic
906648323 1:47491987-47492009 ATTCAGTTGGAGAAGATTATGGG - Intergenic
906966871 1:50466313-50466335 AATCAGATAAGGAAGACTATGGG + Intronic
910435458 1:87201402-87201424 ACACACAGGGGGAAGTCTATGGG - Intergenic
912303330 1:108539293-108539315 GCTCACATGTGGAAGACTGTGGG - Intergenic
912744862 1:112237716-112237738 ATTGAGATGTGGAAGACTGTTGG - Intergenic
915176349 1:154018444-154018466 ACTGAAATGGGGAAGACTGTAGG - Intronic
918915899 1:190635754-190635776 GTTCCTATGGGGAAGACAATTGG + Intergenic
919435983 1:197561717-197561739 ATTGAGATTGGGAAGACTGTGGG - Intronic
919808169 1:201393065-201393087 AATAACATGGGGAAGACCAGGGG + Intronic
920883261 1:209899748-209899770 ATTACCATGGGGAAGACTGAAGG - Intergenic
921337274 1:214100833-214100855 ACTAATATGGGGAAGACTGTTGG + Intergenic
923239071 1:232062925-232062947 AGCCACATGGGGAAGACGCTAGG + Intergenic
1063043394 10:2367671-2367693 TTTAACATTGGGAAGACGATGGG - Intergenic
1063482492 10:6388207-6388229 ATTTACTTTGGGAGGACTATAGG + Intergenic
1063993478 10:11592994-11593016 ATTCACCTGAGGAAGAATAATGG - Intronic
1064750148 10:18520235-18520257 ATTGAGATAGGGAAGACCATGGG - Intronic
1065310616 10:24412918-24412940 ATTGAGATGGGGAAAACTGTGGG - Intronic
1065994240 10:31041468-31041490 ATTCATATGGGGAATAATTTTGG - Intergenic
1072173460 10:92891143-92891165 ACTGAGATGAGGAAGACTATGGG + Intronic
1074709718 10:116167227-116167249 ATTCATTTGGGAAAGACTTTTGG - Intronic
1077907092 11:6543062-6543084 CCTCACATGGGGAAGAGTAAGGG + Intronic
1079300012 11:19269541-19269563 ATTCACTTGGGGAAGATGTTTGG - Intergenic
1079546042 11:21633038-21633060 ATTGAAATAGGGAAGACTGTAGG - Intergenic
1081650810 11:44823020-44823042 ATTCACTGGGGGCTGACTATAGG - Intronic
1087263303 11:96034918-96034940 AGTCACATGGGGAAGCATATGGG + Intronic
1087819299 11:102693480-102693502 ATTCACTTTAAGAAGACTATGGG + Intronic
1088051459 11:105520148-105520170 TTCCAGATGGGAAAGACTATGGG + Intergenic
1090341424 11:126024548-126024570 ACTGAAATGGGGAAGACTAGAGG + Intronic
1090923680 11:131231045-131231067 AAGCACATTGGGAAGACTACAGG - Intergenic
1093073729 12:14735394-14735416 ATTGATGTGGGGAAGACTAGGGG - Intergenic
1093129021 12:15367676-15367698 ACTGAGATGGGGAAGACTACTGG - Intronic
1093766563 12:22970181-22970203 GCTCACATGGGGAAAACCATGGG + Intergenic
1095400174 12:41805264-41805286 ATAGACATGGGGAATACTAGAGG - Intergenic
1097369282 12:58757111-58757133 ATTCCCATGGGAAAGCCTAAGGG - Intronic
1098034306 12:66286744-66286766 ACTGAGATGGGGAAGACTGTAGG + Intergenic
1100541401 12:95560924-95560946 ACTGAAATGGGGAAGACTCTAGG - Intergenic
1103705516 12:122869354-122869376 TTTCACCTGGGGAAGGCTGTTGG - Intronic
1103740866 12:123090766-123090788 CTTCACAGGGGTATGACTATGGG + Intronic
1106826717 13:33530532-33530554 ATTCAGATTGGGAAAACTCTTGG - Intergenic
1107817911 13:44260686-44260708 ATTGACTTGGGGAAGAATCTGGG + Intergenic
1107921151 13:45209587-45209609 AAAGACATGGGGAAGACTTTAGG + Intronic
1109852582 13:68086502-68086524 AATGACATGGGGTAGACTTTGGG - Intergenic
1110255095 13:73425122-73425144 ATCAAGATGGGGAAGACTAGAGG - Intergenic
1115510058 14:34130048-34130070 ATTCTGTTGGGGAAGACCATGGG - Intronic
1115728606 14:36243810-36243832 ATTGAAGTGGGGAAGACTGTGGG + Intergenic
1118542269 14:66841623-66841645 ACTGAAATGGAGAAGACTATGGG + Intronic
1120706619 14:87752460-87752482 CTTCATGTGGGGAAGAATATAGG + Intergenic
1121683136 14:95810955-95810977 ATTGACATAAGGAAGACCATTGG - Intergenic
1129780849 15:78269959-78269981 TGTGATATGGGGAAGACTATGGG + Intronic
1130935869 15:88469926-88469948 ATTAAGATGGGGAAGACTGCAGG + Intronic
1132534807 16:472906-472928 ACACACAGGGGGAAGACCATAGG + Intronic
1134515451 16:14883196-14883218 ACTCTCATTGGGAAGACTAGAGG + Intronic
1134703124 16:16281841-16281863 ACTCTCATTGGGAAGACTAGAGG + Intronic
1134964419 16:18430274-18430296 ACTCTCATTGGGAAGACTAGAGG - Intronic
1134968706 16:18512809-18512831 ACTCTCATTGGGAAGACTAGAGG - Intronic
1137049199 16:35693786-35693808 ATTCAAATGGGAGAGACTACTGG - Intergenic
1137053043 16:35729343-35729365 ATTCTAATGGGAAAGACTACTGG - Intergenic
1139464578 16:67147445-67147467 ATGCACATTGGGAAGACTTGGGG + Exonic
1141016192 16:80452330-80452352 ACTGAGATGGGGAAGATTATGGG - Intergenic
1144425788 17:15140891-15140913 ACTGACATGTGGAAGGCTATGGG + Intergenic
1144763438 17:17720376-17720398 ATTCCCCTGGGGCAGACTCTTGG + Intronic
1145768501 17:27475953-27475975 ATGCATATGGGGAAAACTAGAGG + Intronic
1147890451 17:43713045-43713067 ATTCCCAGGAGGAAGATTATTGG - Intergenic
1149433405 17:56613217-56613239 AGTCACATGAGGAGGAATATAGG - Intergenic
1157161868 18:45320966-45320988 TTTCACATGGGGAAAATTCTGGG + Intronic
1157556419 18:48615799-48615821 ATTCACATGGGGTAGCCCAGCGG - Intronic
1157889466 18:51401610-51401632 ATTCACATGGGAAAGAGAAATGG - Intergenic
1157901277 18:51520495-51520517 ATTCAGCTGGGGAAGGCTCTGGG + Intergenic
1158983059 18:62784129-62784151 CTTCACATGGGGCAGACAGTGGG + Intronic
1161003469 19:1922984-1923006 CTTTACATGGGGAGGACCATGGG + Intronic
1162431420 19:10631183-10631205 ATTCACAGGGGGAAAAGGATGGG - Intronic
1164374277 19:27671940-27671962 ATTCTCATGGGAAAGACTCCTGG - Intergenic
1164385446 19:27767589-27767611 ATTCTAATGGGAAAGACTCTTGG - Intergenic
1164385548 19:27768240-27768262 ATTCTAATGGGAAAGACTACCGG - Intergenic
1164385764 19:27769680-27769702 ATTTTAATGGGGAAGACTACTGG - Intergenic
1165221080 19:34317220-34317242 ATTCTAATGGGGAAGACAACAGG - Intronic
925170836 2:1749474-1749496 ATTCACACTGGGAAGACGGTGGG - Intergenic
926406589 2:12559300-12559322 ATTCCCTTGGGGAACACTGTGGG - Intergenic
926531202 2:14048300-14048322 CTTCACATGTTTAAGACTATAGG - Intergenic
928102583 2:28447966-28447988 AGACACAGGGGGAAGACCATGGG + Intergenic
929209925 2:39344833-39344855 ATGCACATGTGGGAGACTGTGGG + Intronic
936529221 2:113263748-113263770 CTCCACATGGGAAAGACTGTGGG + Intronic
937084966 2:119165518-119165540 AGACACATGAGGAAGACTAAGGG - Intergenic
937528805 2:122803785-122803807 GTTCACCTGGAGAAGACTGTAGG + Intergenic
938303575 2:130232788-130232810 ATTGACATGGGGAAAACTATGGG - Intergenic
938453102 2:131441472-131441494 ATTGACATGGGGACAACTATGGG + Intergenic
938640228 2:133269992-133270014 ATTGAAATGAGAAAGACTATGGG + Intronic
939682978 2:145161695-145161717 ACTGAGCTGGGGAAGACTATGGG - Intergenic
940078985 2:149778615-149778637 ATTGACATGGGAAAGCCTATAGG + Intergenic
941203471 2:162543095-162543117 AGTCACATGGTTAAGACTAAAGG + Intronic
942058109 2:172204192-172204214 ACTGACATGGGGAAGACTGTGGG - Intergenic
944805456 2:203276655-203276677 AATAAGATGGGGAAGACTATGGG + Intronic
944852743 2:203736474-203736496 ATTCACATGGGAAAGTATTTTGG + Exonic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
945572393 2:211485052-211485074 ATCCACATGGGCCAGAGTATTGG + Intronic
945727989 2:213496349-213496371 ATTTATATGGGGAAGACTGAGGG + Intronic
948393846 2:237630677-237630699 ATTGACAAGGGGAAGTATATTGG + Intronic
949005121 2:241641570-241641592 ACTCAGATGGGGAAGACTTGGGG + Intronic
1169419188 20:5445661-5445683 ATTCACATGGAGAAGAATTAAGG - Intergenic
1172652501 20:36513822-36513844 ACTGAAATGGGGAAAACTATAGG + Intronic
1173011813 20:39190007-39190029 GTTTACATGGGTATGACTATGGG + Intergenic
1173493948 20:43505500-43505522 GTTAACATGGAGAAGACAATGGG + Intergenic
1174970758 20:55273087-55273109 ACTGAAATGGAGAAGACTATAGG - Intergenic
1179077532 21:38136955-38136977 AATCAAATGGAGAAAACTATTGG + Intronic
1183169355 22:36174637-36174659 AATCATATGGGTAAGGCTATTGG - Intergenic
949228814 3:1726388-1726410 GTACACATGGGGAAAAATATTGG + Intergenic
951511358 3:23506367-23506389 ATTGATATGGGGAAGACTAGAGG - Intronic
952340185 3:32439044-32439066 ATCTACATGGGGAAGTCTAGGGG - Intronic
952538236 3:34336512-34336534 AATCACATGGGTAAAACTACAGG - Intergenic
955986463 3:64578702-64578724 ATTAAAATGGGGAAGCCTACAGG - Intronic
956903042 3:73736617-73736639 ATTTATATAGTGAAGACTATGGG + Intergenic
957485049 3:80850116-80850138 CTTGACATGGGGCAGATTATGGG - Intergenic
957800254 3:85069157-85069179 TTTCCCATGGGGAAGAATAATGG + Intronic
960823804 3:121761402-121761424 ATTCTGTTGGGGAAGACTCTTGG - Intergenic
963102202 3:141618459-141618481 ACTGAGATGGGAAAGACTATAGG + Intergenic
963297289 3:143559794-143559816 TTTTACATGGAGAAGACTTTTGG - Intronic
963348852 3:144128546-144128568 ATTCTCATGGGAAAGCCTGTAGG - Intergenic
963909159 3:150800417-150800439 ATACAGATGGGGAAGAGTATGGG - Intergenic
964798980 3:160532579-160532601 TTTCACATGTGGGAGACTACAGG + Intronic
965285603 3:166815819-166815841 AATGAAATGGGGAAGACTGTAGG - Intergenic
966462924 3:180197571-180197593 ATATACATGGGGCAGACTTTGGG - Intergenic
967544803 3:190712521-190712543 ATTAAGATGGGGGAGACTAGTGG + Intergenic
968717575 4:2172720-2172742 ATTCTCATGGGTGAGACTCTGGG + Intronic
969325220 4:6440143-6440165 CTTCACATGGGTATGACCATAGG + Intronic
969554605 4:7897920-7897942 ATTGGGATGGGGAAGACTATGGG - Intronic
971317930 4:25582928-25582950 ATTCACCTGGGGATCAGTATAGG - Intergenic
972114333 4:35610367-35610389 ATTCACATGGGTACTACTCTTGG - Intergenic
973082446 4:46011136-46011158 ATTAAGATGAGGAAGACTAAAGG + Intergenic
973630047 4:52811707-52811729 ATTGAGATGGGGAAGACTGGGGG + Intergenic
976341208 4:83947182-83947204 ATCCCCATGGGGAAGGCTAGTGG - Intergenic
979557993 4:122072770-122072792 AATGAAATGGGAAAGACTATAGG + Intergenic
984671555 4:182494909-182494931 TTTCACATGGGAAGTACTATTGG + Intronic
984674444 4:182530859-182530881 ACTGAAATGGGGAAGACTGTGGG + Intronic
987732556 5:21795082-21795104 ATTCACATTGTGAATACTAAAGG - Intronic
989481735 5:41938832-41938854 AGTCACATGGGAAGGAATATAGG - Intronic
990856253 5:60269916-60269938 ATTGAAATGGGGAAGACTAAAGG + Intronic
991532709 5:67633523-67633545 ATTCACATGTGGAAATATATTGG + Intergenic
992865599 5:80954161-80954183 ACTGAGATGAGGAAGACTATGGG + Intergenic
992969401 5:82040517-82040539 ATTCTCAGGGGAAAAACTATTGG + Intronic
997450466 5:133978609-133978631 ATTCAAATGGGGAAGTTTCTTGG + Intronic
999157978 5:149472079-149472101 ATTCACAGGGGGAAGGCTGGAGG + Intergenic
1000871857 5:166586916-166586938 TTGAACATGGGGAAAACTATGGG - Intergenic
1004201298 6:13550395-13550417 ATTCACAGGGGAAATACAATAGG - Intergenic
1006218284 6:32465212-32465234 ATTGAAATAGGGAAGAATATGGG - Intergenic
1006941500 6:37754742-37754764 ACTGAGATGGGGAAGACTATGGG + Intergenic
1007209672 6:40182726-40182748 AGTCAAATGGGGAAGAGTGTGGG + Intergenic
1007944301 6:45811614-45811636 ACTGCCATAGGGAAGACTATGGG - Intergenic
1008440565 6:51527619-51527641 ATTGAAATGGGGGAGGCTATGGG - Intergenic
1009424451 6:63498831-63498853 ATTAACGCAGGGAAGACTATAGG + Intergenic
1009445245 6:63734706-63734728 ACTGAAATGGGGAAGACTGTGGG + Intronic
1010395970 6:75392473-75392495 ACTGAGATGGAGAAGACTATAGG - Intronic
1015891799 6:137977154-137977176 ATTAGCATGAGGAAGACAATTGG + Intergenic
1021593941 7:22294591-22294613 ATTAAGGTGAGGAAGACTATAGG - Intronic
1022010467 7:26304197-26304219 ATTCAGATGGGGAAGGCTGGAGG - Intronic
1022199769 7:28104787-28104809 CTTCCCATGGGGAAGAATAAGGG + Intronic
1024887378 7:54160024-54160046 ATTCAGATGGGAAAAACAATTGG + Intergenic
1026394074 7:69933858-69933880 ATTCACATGGGAAAGAACAAAGG - Intronic
1031200405 7:118676616-118676638 TTTAAGATGAGGAAGACTATAGG + Intergenic
1036100240 8:5774248-5774270 ATTCAGATGGTGAAGGCTGTAGG + Intergenic
1038871575 8:31500527-31500549 ATGCACAAGATGAAGACTATAGG - Intergenic
1039624801 8:39037929-39037951 ATTCACATGGGGAAGACTATGGG - Intronic
1039706271 8:40010730-40010752 ACTCCAATGAGGAAGACTATAGG + Intronic
1040995038 8:53392527-53392549 ATTCTGATGGGGAACAGTATTGG + Intergenic
1042655518 8:71091455-71091477 CTTCCCATGGGAAAGACTGTTGG - Intergenic
1044811073 8:96062791-96062813 ACTCAGCTGGGGAAGACTAGAGG - Intergenic
1047624170 8:126639064-126639086 CTGCAAATGGGGAAGATTATAGG + Intergenic
1047888078 8:129275244-129275266 ATTGACATATGCAAGACTATTGG + Intergenic
1050925343 9:11256903-11256925 GTTAACATGGGGAAGAGGATAGG - Intergenic
1051444471 9:17125782-17125804 ATTGAGATGGTGAAGACTATTGG - Intergenic
1052450104 9:28618223-28618245 ATTGACATGGGGAAGAATAAAGG - Intronic
1054855377 9:69893528-69893550 ATGAAAATGGGGAAGACAATAGG - Intronic
1056483753 9:87033489-87033511 ATTCTCATGGGGTAGACTAATGG + Intergenic
1058903256 9:109460136-109460158 ATTGAGATGGGGAAGACTGTGGG - Intronic
1059947246 9:119422486-119422508 ATTCACCAGGGTAAGACAATAGG - Intergenic
1185737923 X:2507173-2507195 ATTCAGGTGTGGAAGACTTTGGG + Intergenic
1186114830 X:6294300-6294322 ATTCACATGGTGAAAACCAATGG + Intergenic
1186949407 X:14606565-14606587 TAGCAAATGGGGAAGACTATTGG - Intronic
1188025285 X:25201807-25201829 ACTGAGATAGGGAAGACTATGGG + Intergenic
1189121712 X:38402105-38402127 ATTCAAATGTGGAAGAAGATGGG - Intronic
1191240777 X:58188389-58188411 ATTCAAATGGGAGAGACTACTGG + Intergenic
1195198427 X:102521639-102521661 ATTGAGATGGGGAAGGCTGTAGG - Intergenic
1195768012 X:108317287-108317309 ATTCAGATGGAGAAAACTGTTGG + Intronic
1198428089 X:136539878-136539900 ATTGAGATGGGAAAGACTGTGGG - Intronic