ID: 1039630566

View in Genome Browser
Species Human (GRCh38)
Location 8:39107632-39107654
Sequence CCCCGGAGACGGGGTGCTCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039630566_1039630581 23 Left 1039630566 8:39107632-39107654 CCGAGAGCACCCCGTCTCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1039630581 8:39107678-39107700 AACGTGCGGGGAGCGGCCCCCGG 0: 1
1: 1
2: 0
3: 12
4: 81
1039630566_1039630577 11 Left 1039630566 8:39107632-39107654 CCGAGAGCACCCCGTCTCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1039630577 8:39107666-39107688 CGCTGTCCCATGAACGTGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 24
1039630566_1039630575 9 Left 1039630566 8:39107632-39107654 CCGAGAGCACCCCGTCTCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1039630575 8:39107664-39107686 AACGCTGTCCCATGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 34
1039630566_1039630576 10 Left 1039630566 8:39107632-39107654 CCGAGAGCACCCCGTCTCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1039630576 8:39107665-39107687 ACGCTGTCCCATGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1039630566_1039630578 16 Left 1039630566 8:39107632-39107654 CCGAGAGCACCCCGTCTCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1039630578 8:39107671-39107693 TCCCATGAACGTGCGGGGAGCGG 0: 1
1: 0
2: 0
3: 11
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039630566 Original CRISPR CCCCGGAGACGGGGTGCTCT CGG (reversed) Exonic