ID: 1039634776

View in Genome Browser
Species Human (GRCh38)
Location 8:39152604-39152626
Sequence GCCTCCGCTCCCGAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6406
Summary {0: 1, 1: 109, 2: 529, 3: 1820, 4: 3947}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039634776_1039634780 2 Left 1039634776 8:39152604-39152626 CCCAGCTACTCGGGAGCGGAGGC 0: 1
1: 109
2: 529
3: 1820
4: 3947
Right 1039634780 8:39152629-39152651 AAGAATTGTTTGAACCTGGGAGG 0: 78
1: 3243
2: 30146
3: 82209
4: 154679
1039634776_1039634778 -2 Left 1039634776 8:39152604-39152626 CCCAGCTACTCGGGAGCGGAGGC 0: 1
1: 109
2: 529
3: 1820
4: 3947
Right 1039634778 8:39152625-39152647 GCTGAAGAATTGTTTGAACCTGG No data
1039634776_1039634781 5 Left 1039634776 8:39152604-39152626 CCCAGCTACTCGGGAGCGGAGGC 0: 1
1: 109
2: 529
3: 1820
4: 3947
Right 1039634781 8:39152632-39152654 AATTGTTTGAACCTGGGAGGTGG 0: 539
1: 15624
2: 46586
3: 94530
4: 122466
1039634776_1039634782 8 Left 1039634776 8:39152604-39152626 CCCAGCTACTCGGGAGCGGAGGC 0: 1
1: 109
2: 529
3: 1820
4: 3947
Right 1039634782 8:39152635-39152657 TGTTTGAACCTGGGAGGTGGAGG 0: 269
1: 7726
2: 29122
3: 70929
4: 112865
1039634776_1039634779 -1 Left 1039634776 8:39152604-39152626 CCCAGCTACTCGGGAGCGGAGGC 0: 1
1: 109
2: 529
3: 1820
4: 3947
Right 1039634779 8:39152626-39152648 CTGAAGAATTGTTTGAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039634776 Original CRISPR GCCTCCGCTCCCGAGTAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr