ID: 1039635404

View in Genome Browser
Species Human (GRCh38)
Location 8:39159321-39159343
Sequence TGGTTTTTACAGATTGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039635401_1039635404 0 Left 1039635401 8:39159298-39159320 CCAAAAAAGAGAAAAGACTTCCT 0: 1
1: 0
2: 4
3: 53
4: 558
Right 1039635404 8:39159321-39159343 TGGTTTTTACAGATTGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039635404 Original CRISPR TGGTTTTTACAGATTGACTC TGG Intronic
No off target data available for this crispr