ID: 1039635799

View in Genome Browser
Species Human (GRCh38)
Location 8:39163330-39163352
Sequence CAGGGCCCACAAAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039635792_1039635799 5 Left 1039635792 8:39163302-39163324 CCAATGGTAGGGGGCACTCTCCA 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1039635799 8:39163330-39163352 CAGGGCCCACAAAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039635799 Original CRISPR CAGGGCCCACAAAGGGAAGG AGG Intronic
No off target data available for this crispr