ID: 1039645547

View in Genome Browser
Species Human (GRCh38)
Location 8:39278265-39278287
Sequence TTATAGGCACAGAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039645537_1039645547 9 Left 1039645537 8:39278233-39278255 CCTCTCGTCTCTGCCAACTGAGT 0: 1
1: 0
2: 2
3: 42
4: 682
Right 1039645547 8:39278265-39278287 TTATAGGCACAGAATGGGGAGGG No data
1039645534_1039645547 25 Left 1039645534 8:39278217-39278239 CCCTGACGTCCAGCTGCCTCTCG 0: 1
1: 0
2: 2
3: 37
4: 227
Right 1039645547 8:39278265-39278287 TTATAGGCACAGAATGGGGAGGG No data
1039645535_1039645547 24 Left 1039645535 8:39278218-39278240 CCTGACGTCCAGCTGCCTCTCGT 0: 1
1: 0
2: 3
3: 24
4: 145
Right 1039645547 8:39278265-39278287 TTATAGGCACAGAATGGGGAGGG No data
1039645541_1039645547 -4 Left 1039645541 8:39278246-39278268 CCAACTGAGTCTGGGGTCTTTAT 0: 26
1: 54
2: 51
3: 73
4: 207
Right 1039645547 8:39278265-39278287 TTATAGGCACAGAATGGGGAGGG No data
1039645536_1039645547 16 Left 1039645536 8:39278226-39278248 CCAGCTGCCTCTCGTCTCTGCCA 0: 1
1: 1
2: 12
3: 54
4: 419
Right 1039645547 8:39278265-39278287 TTATAGGCACAGAATGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039645547 Original CRISPR TTATAGGCACAGAATGGGGA GGG Intronic
No off target data available for this crispr