ID: 1039646370

View in Genome Browser
Species Human (GRCh38)
Location 8:39288764-39288786
Sequence AAATCTGCTGATAGTTGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 923
Summary {0: 2, 1: 4, 2: 23, 3: 127, 4: 767}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039646369_1039646370 -3 Left 1039646369 8:39288744-39288766 CCTGGCTTGTTTCTGCTGAGAAA No data
Right 1039646370 8:39288764-39288786 AAATCTGCTGATAGTTGTATTGG 0: 2
1: 4
2: 23
3: 127
4: 767

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039646370 Original CRISPR AAATCTGCTGATAGTTGTAT TGG Intergenic
901189530 1:7399832-7399854 AAATCTGCTGATAGTTTAATGGG + Intronic
901611649 1:10503376-10503398 AAAACCGCTGACTGTTGTATTGG - Intronic
906870800 1:49478379-49478401 AAATCTGCTGCTAGACATATTGG - Intronic
906900950 1:49835941-49835963 AGATCTGCTGTTAGTTTGATGGG + Intronic
906910686 1:49945344-49945366 AAATCTGCTGTTAATTTGATAGG - Intronic
906915686 1:50006589-50006611 AAGTCTGCTGCCAGGTGTATTGG - Intronic
907202703 1:52741346-52741368 AAATCTCCTCTTAGTTGTTTGGG - Intronic
908363046 1:63388928-63388950 AAGTCTGCTGCCAGATGTATTGG + Intronic
908833292 1:68203304-68203326 AAATAAACAGATAGTTGTATTGG - Intronic
908908184 1:69039977-69039999 AAATCTGCTGCCAGATATATTGG - Intergenic
909084232 1:71152802-71152824 AAGTCTGCTGCTAGGTGTATTGG + Intergenic
909411906 1:75364022-75364044 AAATCTGCTGACAGATGTATTGG + Intronic
909870509 1:80732746-80732768 AAGTCTGCTGCCAGATGTATTGG - Intergenic
910147914 1:84104377-84104399 TAATCTGTTGATAGATGTTTAGG + Intronic
911217791 1:95215050-95215072 AAATCTGCTGTTAGTCTGATGGG + Intronic
911241189 1:95469342-95469364 AAGTCTGCTGCTAGATGTATTGG + Intergenic
911313061 1:96320257-96320279 ACATCTGCTGATAGTCTAATGGG - Intergenic
911452539 1:98082732-98082754 AAATCTATTGATATTTTTATTGG + Intergenic
911925141 1:103819651-103819673 AAATCTGCTGTTAGTCTGATGGG - Intergenic
911987986 1:104655942-104655964 AAGTCTGCTGCCAGATGTATTGG + Intergenic
912051219 1:105530179-105530201 AAATCTGCTTTCAGTTGTTTTGG + Intergenic
912119346 1:106451180-106451202 AAATCTTCTGATAAATGAATAGG - Intergenic
912133169 1:106627124-106627146 AAATCTGCTGTTAGTCTAATGGG + Intergenic
912277889 1:108279927-108279949 AAATCTACTGATAGTTGTATTGG + Intergenic
912290337 1:108414432-108414454 AAATCTACTGATAGTTGTATTGG - Intronic
912431661 1:109631321-109631343 GAATCTGCTCATTGTTGTTTGGG + Exonic
912588499 1:110788803-110788825 AAATCTGCTGTTAGTCTAATGGG - Intergenic
912856587 1:113173655-113173677 AAATCTGCTGTTAGTCTGATGGG - Intergenic
913080495 1:115380691-115380713 CAATCTGCTAAAAGGTGTATAGG - Intergenic
913972884 1:143429246-143429268 AAATCTGCTGTTAGTTTGATAGG + Intergenic
914067268 1:144254853-144254875 AAATCTGCTGTTAGTTTGATAGG + Intergenic
914111885 1:144711501-144711523 AAATCTGCTGTTAGTTTGATAGG - Intergenic
914964294 1:152240261-152240283 AATTCTGCTGAAAATTGTATTGG + Intergenic
915683626 1:157607643-157607665 AAGTCTGCTGCCAGGTGTATTGG - Intergenic
916032946 1:160894193-160894215 AGATCTGCTGTTAGTTTGATGGG - Intergenic
916322008 1:163514638-163514660 AAGTCTGCTGCCAGATGTATTGG - Intergenic
916360731 1:163964419-163964441 AAGTCTGCTGCCAGATGTATTGG - Intergenic
916371468 1:164100965-164100987 ATATTTTCTGATAGTTTTATGGG + Intergenic
916453695 1:164948310-164948332 AAATCTGCTGATAGTCCTATGGG + Intergenic
916616208 1:166443549-166443571 AAATCTGTTGCCAGATGTATTGG + Intergenic
916909430 1:169329975-169329997 AAGTCTGTTGCTAGATGTATTGG - Intronic
917003152 1:170383828-170383850 AAGTCTGCTGCCAGATGTATTGG + Intergenic
917061514 1:171047019-171047041 AAGTCTGCTGCCAGATGTATTGG + Intronic
917096769 1:171406161-171406183 AAATCTGCTGTTAATTCAATAGG - Intergenic
917177952 1:172260182-172260204 AAATCTGCTGTTAGTCTGATGGG + Intronic
917306467 1:173629948-173629970 AAGTCTGTTGCTAGATGTATTGG - Intronic
917378444 1:174377307-174377329 AAATCTGCTGAGATTTTTATTGG - Intronic
917664923 1:177216857-177216879 AAGTTTGCTGATAGTTTTATTGG + Intronic
917768392 1:178248902-178248924 AAATCTGCTGTTAGTCTGATGGG + Intronic
917827563 1:178839290-178839312 AGATCTGCTGTTAGTTTGATGGG - Intronic
917917211 1:179714409-179714431 AAATCTGCTGAACGCTGTATTGG + Intergenic
918018545 1:180662480-180662502 AAGTCTGCTGCCAGATGTATTGG + Intronic
918598745 1:186326347-186326369 AATTGTCCTGAGAGTTGTATGGG + Intronic
918664394 1:187131405-187131427 AAATCTGCTGATAGTCTAATAGG - Intergenic
918756288 1:188342633-188342655 AAGTTTGCTGCTAGATGTATTGG + Intergenic
918986253 1:191631053-191631075 AAGTCTGCTGCCAGATGTATTGG - Intergenic
919010046 1:191948431-191948453 AAATCTGCTCATCGTTATATGGG + Intergenic
919191036 1:194219367-194219389 AAATCTGCTGCCAGATGGATTGG - Intergenic
919290915 1:195629236-195629258 GAATCTGCTGATAGTCATATAGG - Intergenic
919622066 1:199874083-199874105 TCATCAGCTGATAGATGTATGGG - Intergenic
920643217 1:207774746-207774768 ACATCCGCTGATAGTTGGATAGG + Intronic
920800096 1:209178382-209178404 AAATCTGCTGATAGTCTTATAGG - Intergenic
920904860 1:210153341-210153363 AAACCTGCCGATATTTTTATTGG + Intronic
921042844 1:211450181-211450203 AAATCTGCTGCTAAATGTATTGG - Intergenic
921288657 1:213633326-213633348 AAATCTGCTGTTAGTCTGATGGG - Intergenic
921752439 1:218811563-218811585 AAATCTGCTGACAGATGAGTAGG + Intergenic
921800533 1:219397914-219397936 AGGTCTGCTGTTAGTTGGATGGG + Intergenic
921994192 1:221398938-221398960 AAATCTGCTGCCAAATGTATTGG - Intergenic
922014308 1:221629002-221629024 AAGTCTGCAGCTAGATGTATTGG + Intergenic
922044497 1:221930325-221930347 AAGTCTGCTGTTAGATATATTGG - Intergenic
922378463 1:224995405-224995427 AAATCTGCTGATTGTTATACTGG + Intronic
922642881 1:227252981-227253003 AAATCTGCTGAAAGATGTGGAGG + Intronic
922708603 1:227808068-227808090 AAATCCACTGACAGCTGTATTGG - Intergenic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
924066345 1:240226324-240226346 AAGTCTGCTGTTAGTATTATTGG - Intronic
924484319 1:244465757-244465779 AAATCTGCTGAGATTTTGATTGG + Intronic
924491998 1:244547114-244547136 AAGTCTGATGCTAGGTGTATTGG - Intronic
924515974 1:244766549-244766571 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1062765672 10:62844-62866 AAGTCTGCTGTCAGATGTATTGG + Intergenic
1062884008 10:1002771-1002793 AAATCTGCTGTTAGTCTAATGGG + Intronic
1063305977 10:4901002-4901024 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1063479385 10:6360595-6360617 ATATCTGTTGATAGCTGTATCGG + Intergenic
1065337864 10:24673148-24673170 AAATCTGCTGAGATTTTGATTGG - Intronic
1066148642 10:32590837-32590859 AAGTCTGCTGCCAGATGTATTGG + Intronic
1066747253 10:38613045-38613067 AAATCTGCTGTTAGTTTGATAGG - Intergenic
1068183957 10:53561470-53561492 AAATCTGCTGTTAGTCTGATAGG - Intergenic
1068239013 10:54279675-54279697 GAATCTGCTGCTAATTGTAATGG - Intronic
1068340192 10:55691679-55691701 AAATCTGCTGATAATCTAATGGG + Intergenic
1068596992 10:58913090-58913112 AAATCTGCTGTTAGGTTTCTGGG - Intergenic
1069093293 10:64228349-64228371 AGATCTGCTGTTAGTTTGATGGG + Intergenic
1069147994 10:64919258-64919280 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1069343681 10:67441595-67441617 AAGTCTGCTGCCAGATGTATTGG - Intronic
1070663444 10:78326688-78326710 AAATCCACTGTTAGTTGAATTGG + Intergenic
1071197031 10:83173812-83173834 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1071210984 10:83341735-83341757 AAATCTGCTGTTAGTCTGATGGG + Intergenic
1071512848 10:86275480-86275502 AAATATGCTGAAAGTGGTAAAGG + Intronic
1071896553 10:90074349-90074371 AATTCTGCTGCCAGATGTATTGG + Intergenic
1072358774 10:94638712-94638734 AAATCTGCTGTTAGTCTGATGGG + Intergenic
1073661291 10:105479369-105479391 AGATCTGCTGTTAGTCTTATGGG + Intergenic
1073960411 10:108920219-108920241 AAATCTGCTGTTAATCTTATAGG - Intergenic
1074254378 10:111785486-111785508 AAATCTAATTATTGTTGTATAGG + Intergenic
1074409003 10:113208050-113208072 AAATATGCTGATAGTATTATGGG - Intergenic
1074645808 10:115450728-115450750 AATGCTGCTGGTAGTTTTATGGG - Intronic
1078743231 11:14088494-14088516 AGATCTGCTGTTAGTCTTATGGG + Intronic
1078812005 11:14777536-14777558 AAATCTGCTATTACTTGAATTGG - Intronic
1078981332 11:16538104-16538126 AGATCTGCTGTTAGTCTTATGGG - Intronic
1078998542 11:16729357-16729379 AGATCTGCTGTTAGTCTTATGGG - Intronic
1079473682 11:20806393-20806415 AAGTCTGCTGCCAGATGTATTGG + Intronic
1079577986 11:22026723-22026745 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1079683108 11:23322736-23322758 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1079687033 11:23372119-23372141 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1079935626 11:26612854-26612876 AAATCTGCTGATAGTCTAATAGG + Intronic
1080084027 11:28257241-28257263 AAGTCTGCTGCTAGTTCTATTGG + Intronic
1080489586 11:32748897-32748919 AAGTCTGCTGCCAGATGTATTGG + Intronic
1080989737 11:37516808-37516830 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1081045052 11:38263492-38263514 AATTCTGATGTTAGATGTATTGG + Intergenic
1081118456 11:39233841-39233863 ACATCTGCTGTTTGTTGGATGGG - Intergenic
1081177235 11:39944038-39944060 AAGTCTGCTGCTAGTTTTATTGG + Intergenic
1081682231 11:45016158-45016180 AAATCTGCTGTTAGTCTGATGGG + Intergenic
1082225451 11:49701460-49701482 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1082955074 11:58862167-58862189 AAATCTGCTGTTAGCCTTATTGG + Intronic
1082970386 11:59014237-59014259 GAATCTGCTGTCAGATGTATTGG - Intronic
1083128300 11:60595907-60595929 AAGTCTGCCGATAGCTGTATTGG - Intergenic
1085493398 11:76944565-76944587 AAGTCTGCTGTTAGTTTGATGGG + Intronic
1085827846 11:79866472-79866494 AGATCTGCTATTAGTTGGATGGG - Intergenic
1086050640 11:82585921-82585943 AAGTCTGCAGCTAGATGTATTGG - Intergenic
1086082740 11:82922072-82922094 AAATCTGCTGTTAATCGGATAGG + Intronic
1086623630 11:88918112-88918134 AAGTCTGCTGCCAGATGTATTGG - Intronic
1087031769 11:93713517-93713539 AAGTCTGCTGCTAGACGTATTGG + Intronic
1087162418 11:94961715-94961737 AAATATGCTTATAGATGTAATGG - Intergenic
1087359499 11:97140332-97140354 AAATTTGCTGATAGATGTGCTGG + Intergenic
1087720806 11:101663780-101663802 AAGTCTGCTGCTGGATGTATTGG + Intronic
1087877132 11:103371590-103371612 AAGTCTGCTGCCAGATGTATTGG - Intronic
1088009959 11:104987790-104987812 AAGTCTGCTGCTAGATATATTGG - Intergenic
1088121152 11:106371529-106371551 AAACCTGCTGATATTTTGATTGG + Intergenic
1088176140 11:107054735-107054757 AAATCTGCTGTTTGTTTGATAGG - Intergenic
1088387896 11:109280318-109280340 AAATCTGCTGTTAATTTGATAGG + Intergenic
1088691183 11:112329967-112329989 ACATCTGCTGTTAGTTTGATGGG + Intergenic
1089512619 11:119009711-119009733 AACACTGTTGATAGTGGTATTGG + Intronic
1089946694 11:122481412-122481434 AAATCTGCTGCCAGATGTATTGG - Intergenic
1089952149 11:122538231-122538253 AAATCTGCTGATAGTCTAATGGG - Intergenic
1090394649 11:126410853-126410875 ACATCTGCTGAGAGATGTCTGGG + Intronic
1090560175 11:127924036-127924058 AAAGCTGATGATTGTTTTATTGG + Intergenic
1090979516 11:131705259-131705281 AAATCTGCTGATAGTCCTACAGG - Intronic
1091083966 11:132702405-132702427 AAATCTGCTGATAGTTTTATGGG + Intronic
1092326553 12:7537566-7537588 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1092504637 12:9083964-9083986 AAATCCATGGATAGTTGTATTGG - Intronic
1092642572 12:10531915-10531937 AAGTCTGCTGGAAGATGTATTGG - Intergenic
1092926610 12:13278065-13278087 AAATCTGTTTATAGTTGGAATGG - Intergenic
1093123118 12:15296661-15296683 AAGTCTGCTGCCAGGTGTATTGG - Intronic
1093391296 12:18626770-18626792 AAGTTTGCTGGTAGTTGTATTGG + Intronic
1093599035 12:20999870-20999892 AAGTCTGCTGTTAGTCTTATAGG + Intergenic
1093620245 12:21279489-21279511 AAGTCTGCTGCCAGTTGTATTGG - Intronic
1093991583 12:25594341-25594363 AAATCTACTGTTAATTGGATGGG - Intronic
1094559430 12:31536864-31536886 AAATCTGCTGCCAAATGTATTGG - Intronic
1094757696 12:33491251-33491273 AAATATGCTGCCAGATGTATTGG - Intergenic
1094808707 12:34116266-34116288 AAATCTGCTGTTAATTTGATAGG - Intergenic
1095082231 12:38017005-38017027 AAATCTGCTGAAAGATATTTTGG + Intergenic
1095115447 12:38346183-38346205 AAATCTGCTGTTAATTTTATAGG - Intergenic
1095167077 12:38986047-38986069 AAATCTGCTGATAGTTTTACAGG - Intergenic
1095500895 12:42837770-42837792 AAATCTGCTGTTAGTCTGATAGG + Intergenic
1095807945 12:46341829-46341851 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1096397512 12:51277565-51277587 AATTATGGTGATAGTTTTATGGG - Intergenic
1097362957 12:58678538-58678560 AAATCTACTGTTAGTTTGATGGG + Intronic
1097553283 12:61103378-61103400 AAGTCTACTGCTAGATGTATTGG + Intergenic
1097743010 12:63267592-63267614 AAATCTGATGATATTTCTTTGGG + Intergenic
1098129857 12:67338719-67338741 AAATCTGCTGTTAGTCTGATAGG + Intergenic
1098395496 12:70012634-70012656 ATGTCTGCTGAGAGATGTATTGG - Intergenic
1098742136 12:74186214-74186236 AAATCTGCTGCTAGTCTTATTGG - Intergenic
1098960763 12:76737854-76737876 AAATCTGCTGTTAATCTTATAGG + Intergenic
1099430633 12:82580282-82580304 AAATCTGTTGATAGTCTTATGGG - Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099763986 12:86959237-86959259 AAGTCTGCAGCTAGATGTATAGG + Intergenic
1100683776 12:96962002-96962024 AAATCTGCTGATAATCTAATAGG - Intergenic
1100765235 12:97856834-97856856 AAATCTGCTGGAAGCCGTATTGG - Intergenic
1100915624 12:99417863-99417885 AAATCCACTGATAGTTACATTGG - Intronic
1103267421 12:119642757-119642779 AAAAATGCTGAAATTTGTATTGG - Exonic
1104702133 12:130914693-130914715 AAATCTGCTGAGATTTTTATTGG - Intergenic
1105201542 13:18183956-18183978 AGATCTGCTGTTAGTCGGATGGG - Intergenic
1105558826 13:21471631-21471653 AAGTCTGCTGTCAGTGGTATTGG + Intergenic
1106462751 13:29987513-29987535 AAATCTGCTGTTAGTCTAATTGG + Intergenic
1106583665 13:31038591-31038613 AAATGCCCTGATAGTTGGATGGG + Intergenic
1106963880 13:35036755-35036777 AAGTCTGCTGCCAGATGTATTGG + Intronic
1108032101 13:46242700-46242722 TAATCTGCTGAAAGCTGTACTGG - Intronic
1108054832 13:46475175-46475197 AAAGCAGCTGAAAGTTGTTTGGG - Intergenic
1108469619 13:50755052-50755074 AAATCTGCTGTTAGTCTGATAGG + Intronic
1109150780 13:58844833-58844855 AAATCTGCTGTTAGTCTGATAGG - Intergenic
1109275625 13:60300547-60300569 AAATCTGCTGCGACTTCTATTGG - Intergenic
1109323898 13:60844491-60844513 AAATATCCTGATAGTTGTATGGG + Intergenic
1109504737 13:63285623-63285645 AAATCTGCTGTTAGTCTTATAGG + Intergenic
1109635357 13:65108267-65108289 AGATCTGCTGTTAGTCTTATGGG + Intergenic
1109782626 13:67131949-67131971 AAATGTGCTGATGGATGGATAGG - Intronic
1109964046 13:69668511-69668533 AGATCCGCTGTTAGTTTTATGGG - Intergenic
1110486769 13:76054145-76054167 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1110974360 13:81810043-81810065 AAGTCTGCTGACTGATGTATTGG - Intergenic
1111130558 13:83969546-83969568 AAATCTGCTGAAAGGTGTATTGG - Intergenic
1112068728 13:95824153-95824175 AAGTCTGCTGTTAGTCGGATAGG + Intronic
1113344520 13:109463120-109463142 AAATATGCTGATACTTATATTGG + Intergenic
1113536833 13:111074488-111074510 AAATCTGCTGTTAGTCTAATGGG + Intergenic
1114030628 14:18576738-18576760 AAATCTGCTGTTACTTTGATAGG + Intergenic
1114072470 14:19125420-19125442 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1114089790 14:19274555-19274577 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1114395974 14:22361815-22361837 AAGTCTGCTGATAGTGTTGTGGG + Intergenic
1114692162 14:24594129-24594151 AAATCTGCTGTTAATTGGATAGG + Intergenic
1114761419 14:25320601-25320623 AAATCTGCTGCTAGATGTACTGG + Intergenic
1114984959 14:28215777-28215799 AAGTCTGCTGTCAGATGTATTGG + Intergenic
1115476877 14:33823306-33823328 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1115537811 14:34389686-34389708 AAATCTGCTGTCAGATGTATTGG - Intronic
1115930322 14:38483939-38483961 AAATCTGCTGCCAGATGTATTGG - Intergenic
1115940146 14:38600164-38600186 AAATCTGCTGTTAGTCTGATGGG + Intergenic
1116044725 14:39730828-39730850 AAATCTGCTGTTAATCTTATAGG + Intergenic
1116058061 14:39887636-39887658 AAGTCTGCTGTCAGATGTATTGG - Intergenic
1116079927 14:40158666-40158688 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1116115626 14:40645960-40645982 AAATCAGCTATTAGTTTTATTGG - Intergenic
1116220720 14:42084151-42084173 AAATCTGCTGCTAGATGTATTGG + Intergenic
1117110526 14:52448323-52448345 AAGTCAGCTGCTAGGTGTATTGG - Intronic
1117112926 14:52476953-52476975 AAATCTGCTGTTAGTCTGATAGG - Intronic
1117124594 14:52608785-52608807 AAGTCTGCTGCCAGGTGTATTGG + Intronic
1117159184 14:52972004-52972026 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1117928028 14:60805772-60805794 AAATCTGCTGAAGGATGTCTTGG + Intronic
1118373287 14:65155882-65155904 AAAGCTGCTTATAGTTGAAATGG + Intergenic
1118385154 14:65250149-65250171 AAGTCTGCGGATAGTAGTTTTGG + Intergenic
1118540281 14:66815444-66815466 ATGTCTGCTGTTAGTTGGATGGG - Intronic
1120107469 14:80513328-80513350 AAGTCTGCTGACAGATGTATGGG + Intronic
1120151216 14:81036368-81036390 AAATCTGCTGATAGTCTAGTGGG - Intronic
1120770890 14:88379336-88379358 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1122527575 14:102398938-102398960 AAATCTGCTTATAATCTTATTGG - Intronic
1123481014 15:20630855-20630877 AGATCTGCTGATAGTCTGATGGG - Intergenic
1123636997 15:22369510-22369532 AGATCTGCTGATAGTCTGATGGG + Intergenic
1123895741 15:24828021-24828043 AAATATGCTGTTATGTGTATAGG - Intronic
1124021551 15:25929834-25929856 AAATCCACTGAAAGCTGTATTGG + Intergenic
1124087992 15:26569732-26569754 TAATCTGCTGATAGTGGCAGCGG - Intronic
1124091017 15:26600513-26600535 AAGTCTGCTGATAGTCGTATTGG - Intronic
1124557298 15:30737743-30737765 AAATCTGCTGTTAGTCTGATAGG - Intronic
1124810710 15:32935323-32935345 AAATCTTCTGATAGTCTTGTTGG + Intronic
1124844027 15:33273365-33273387 AACTCTGCTGCCAGATGTATTGG + Intergenic
1125189715 15:36976621-36976643 AGATCTGCTGCTATTTGTCTAGG - Intronic
1125220025 15:37321722-37321744 AGATCTGCTGTTAGTTTTTTGGG - Intergenic
1125432630 15:39610757-39610779 AAATCTGCTGGTTGCTGTTTTGG - Intronic
1126250608 15:46564010-46564032 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1126252149 15:46580069-46580091 AAATGTACTGTTAGATGTATGGG + Intergenic
1126384677 15:48082230-48082252 AAACCTGCTGCTATTTTTATTGG + Intergenic
1126486342 15:49185960-49185982 AAGTGTGCTGACAGTTGTAATGG + Intronic
1126542330 15:49837588-49837610 AGATCCGCTGTTAGTTTTATGGG + Intergenic
1126552809 15:49952056-49952078 AGATCTGCTGATAGTCTGATGGG + Intronic
1126660529 15:51029004-51029026 AAGTCTGCTGCTAGTTGTACTGG + Intergenic
1127140630 15:55971910-55971932 AAACCTGCTGCCAGATGTATTGG - Intronic
1127177838 15:56380775-56380797 AAGTCTGCTGCTAGATGTATTGG + Intronic
1127194622 15:56570163-56570185 AAATCTGCTGTTAATCGGATAGG - Intergenic
1127201637 15:56659935-56659957 AAAGCTGCAGATAGTTGGGTAGG - Intronic
1127339256 15:58023579-58023601 AAATCTGCTGTTAGTTTGATGGG - Intronic
1127410333 15:58699078-58699100 AAATCTGCTGTTAGTCTGATAGG - Intronic
1128524054 15:68399026-68399048 AAATTTGCTGAGATTTTTATTGG - Intronic
1128954993 15:71931450-71931472 AAATCTGATGATAGTCTTGTGGG + Intronic
1129309793 15:74698791-74698813 TAATATGCTGATACTTGGATTGG + Intergenic
1129581015 15:76809888-76809910 AAATCTACTGATAGTGTTATGGG - Intronic
1130142383 15:81238975-81238997 AAATCTGCTGTCATTTGAATTGG + Intronic
1130365837 15:83237718-83237740 AAATCAAATGATAGTTGTATTGG - Intergenic
1130720822 15:86384372-86384394 AAATCAGCTGATAGATTGATGGG + Intronic
1133833694 16:9348690-9348712 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1134340267 16:13338423-13338445 ATATCTGCTGATATTTGAAGTGG + Intergenic
1134897851 16:17905680-17905702 AAATCTGCTGTTAGTCTTATTGG - Intergenic
1135730524 16:24891266-24891288 AAAGCTGCTGATATTTGCAAAGG + Intronic
1135952256 16:26925960-26925982 AAGTCTGCTGACAGTTGCATGGG - Intergenic
1136735814 16:32466601-32466623 AAATCTGCTGTTAGTTTGATAGG + Intergenic
1137311833 16:47269731-47269753 AAGTCTGCTGAGAATTTTATTGG - Intronic
1137996115 16:53215241-53215263 AACTGTGCTGATAAATGTATTGG + Intronic
1138871776 16:60897395-60897417 AATTCTGCTGATATATTTATTGG + Intergenic
1139077628 16:63472347-63472369 AACTCAGGTGATATTTGTATTGG + Intergenic
1139103630 16:63800295-63800317 AAATCTGCTGCTAGACATATTGG + Intergenic
1140563783 16:76015519-76015541 AAATCTGCTGATAATTTTATGGG + Intergenic
1141247516 16:82323439-82323461 AAATCTGCGGTTAGTCGAATGGG + Intergenic
1203017261 16_KI270728v1_random:362973-362995 AAATCTGCTGTTAGTTTGATAGG - Intergenic
1203035596 16_KI270728v1_random:636131-636153 AAATCTGCTGTTAGTTTGATAGG - Intergenic
1144377188 17:14656010-14656032 AAATCTGCTGATAGCTTCGTGGG + Intergenic
1146215696 17:30978089-30978111 AAGTCTGCTGCCAGATGTATTGG + Intronic
1150540299 17:66089964-66089986 AAATCCGCTGCTAGTCTTATTGG - Intronic
1152958478 18:62192-62214 AAGTCTGCTGTCAGATGTATTGG + Intronic
1153268135 18:3292100-3292122 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1153400634 18:4680381-4680403 AAATCTGCTGTTAATTGGATAGG - Intergenic
1153532824 18:6067160-6067182 AAATCTGCTGTTAGTTGGATAGG + Intronic
1153612547 18:6900925-6900947 AAATCTGCTATTATTTGAATTGG - Intronic
1153907172 18:9672292-9672314 AATCCTGTTGATAGTTTTATTGG + Intergenic
1155573668 18:27222519-27222541 AAATCTGCTGTTAATCGGATAGG + Intergenic
1156732357 18:40209653-40209675 ATTTCTTCTGAAAGTTGTATAGG + Intergenic
1159896291 18:73999989-74000011 AAATCTGCAGCCAGATGTATTGG + Intergenic
1160296159 18:77638874-77638896 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1162666575 19:12218609-12218631 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1162692624 19:12446559-12446581 AAGTCTTCTGCCAGTTGTATTGG + Intronic
1163990059 19:20989963-20989985 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1164365360 19:27575336-27575358 AAATCTACAAAGAGTTGTATGGG + Intergenic
1164422575 19:28108147-28108169 AAGTCTTCTGTTAGTTGGATGGG - Intergenic
1164797916 19:31050138-31050160 AACTCTGCTGAAATTTTTATAGG + Intergenic
1164946889 19:32302973-32302995 AAATCTGCTGATAACCTTATGGG + Intergenic
1166275149 19:41748343-41748365 AAATCTGCTGTTGGTTTTCTGGG + Intronic
1166408068 19:42537557-42537579 AAGTCTGCTGCCAGATGTATTGG + Intronic
1168447478 19:56433145-56433167 ATATATCCTGATAGTTGTGTGGG + Intronic
925249418 2:2419739-2419761 AAGTCTGCTGTTAGATGTTTTGG + Intergenic
925441762 2:3893970-3893992 AAATCTGCTGTAAATTGGATAGG + Intergenic
925750249 2:7083488-7083510 AAATCTGCTGAGAGTTGTTAAGG + Intergenic
926494126 2:13562873-13562895 AAGTCTGCTGCTATCTGTATAGG - Intergenic
926939809 2:18123491-18123513 AACTCTGCTCATATTTGAATGGG + Intronic
927306901 2:21583931-21583953 ACATCTGCTGTTAGTCTTATGGG - Intergenic
927309603 2:21615785-21615807 AAATATGCTAACAGATGTATTGG + Intergenic
927328181 2:21831200-21831222 AAATCTGCTGTTAATTTCATAGG + Intergenic
928495482 2:31827553-31827575 AAGTCTGCTGCCAGATGTATTGG + Intergenic
928768164 2:34672519-34672541 AAGTCTGCTGCCAGGTGTATTGG - Intergenic
928798702 2:35058974-35058996 AAATCTGCTGTTAATTTGATAGG + Intergenic
928814279 2:35272393-35272415 AAATCAGCTGATAGTACCATGGG + Intergenic
928834521 2:35528090-35528112 AAGTCTGCTGTCAGTTGTACTGG + Intergenic
929237448 2:39621226-39621248 ATATGTTCTGATAGTTCTATTGG + Intergenic
930041295 2:47126869-47126891 AAGTCTGCTGTCAGATGTATTGG + Intronic
930288627 2:49466179-49466201 AAGTCTGCTGGTAGATATATTGG + Intergenic
930294139 2:49532206-49532228 AAATCTGTTGAAAGTCTTATTGG - Intergenic
930507412 2:52301647-52301669 AAATCTGCAGAGATTTTTATTGG + Intergenic
930981076 2:57526948-57526970 AAGTCTGCTGCCAGATGTATTGG + Intergenic
931136145 2:59403421-59403443 AAATCTGCTGTTAATCTTATAGG - Intergenic
931580615 2:63768425-63768447 AAATCTGCTGAAATTTTGATAGG + Intronic
931841447 2:66154137-66154159 AAATCTGCTGTTAGTCTTATGGG + Intergenic
932059474 2:68481463-68481485 AAATCTGCTGTTAGTCTAATGGG + Intronic
932083993 2:68741238-68741260 AAATCTGCTCCTAATTGTACTGG + Intronic
933053589 2:77632759-77632781 AAGTCTGCTGCCAGATGTATTGG + Intergenic
933227341 2:79766383-79766405 AAGTCTGCTGCCAGATGTATTGG + Intronic
933388021 2:81636004-81636026 AAGTCTGATGTTAGTAGTATTGG - Intergenic
933535252 2:83564922-83564944 GAATCAGCCCATAGTTGTATTGG + Intergenic
933601176 2:84332047-84332069 AAAGCTGCTGTCAGATGTATCGG - Intergenic
933649257 2:84836406-84836428 AAATCTGCTGTTAATCCTATTGG + Intronic
933884941 2:86710371-86710393 AAATCTGCTGTCACTTGAATTGG + Intronic
933925232 2:87086317-87086339 AAATCTGCTGTCACTTGAATTGG - Intergenic
934111244 2:88745640-88745662 AAATCTGCTGTTAATTTGATAGG + Intronic
934177580 2:89590202-89590224 AAATCTGCTGTTAGTTTGATAGG + Intergenic
934186979 2:89755707-89755729 AAATCTGCTGTTAGTTTGATAGG + Intergenic
934287877 2:91664503-91664525 AAATCTGCTGTTAGTTTGATAGG + Intergenic
934873057 2:97885636-97885658 AAATCTGCTGTTAGTTTAATGGG + Intronic
935483426 2:103621880-103621902 AAATCTGCTGATAGCCATATTGG - Intergenic
936511062 2:113147648-113147670 CAGTCTGCTGCTAGATGTATTGG + Intergenic
936825218 2:116574292-116574314 AAGTCTGCTGCCAGATGTATTGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936859779 2:117002896-117002918 AAATCTGCTGTTAGTCTGATGGG - Intergenic
936885226 2:117301799-117301821 AAGTCTGCTGCTAGATGTATTGG - Intergenic
936909759 2:117578088-117578110 AAATCTGCTGATAGCTGTGTTGG - Intergenic
937572613 2:123382305-123382327 AAATCTGCTGTTAATTTGATAGG - Intergenic
938177698 2:129151413-129151435 AAGTCTGCTGTCAGATGTATTGG + Intergenic
938217177 2:129528154-129528176 AAGTCTGCTGCCAGATGTATTGG - Intergenic
938486711 2:131718904-131718926 AAGTCTGCTGCCAGATGTATTGG + Intergenic
938497578 2:131809029-131809051 AAATCTGCTGTTAGTTTGATAGG - Intergenic
938598096 2:132810147-132810169 AAATCTGCTGTTAATCTTATAGG + Intronic
939085354 2:137711809-137711831 AAATCCACTGAAAGTTGTACTGG - Intergenic
939380780 2:141433625-141433647 AAGTCAGCTGATAGTTTTGTTGG + Intronic
939380799 2:141433954-141433976 AAGTCAGCTGATAGTTTTGTTGG + Intronic
939443009 2:142274320-142274342 AAGTCTGCTGCCAGATGTATTGG + Intergenic
939483211 2:142776241-142776263 AAGTCTGCTGCCAGATGTATTGG + Intergenic
939599188 2:144167204-144167226 AACCCTTCTGATAGTTGGATGGG - Intronic
939841251 2:147189752-147189774 AAACCTGCTGATAATCATATGGG - Intergenic
939939024 2:148327200-148327222 AGATCTGCTGTTAGTCTTATGGG + Intronic
940131243 2:150385530-150385552 AAATCTGCTGCTAGTCTTATAGG + Intergenic
940150309 2:150592861-150592883 AATTCTGCTGGAAGTTGTCTGGG - Intergenic
940314887 2:152318283-152318305 AAATCTGCTGCTAGATGTATTGG + Intergenic
940423536 2:153506702-153506724 AAATCTGCTGTTACTCTTATAGG + Intergenic
940425577 2:153527325-153527347 ATGTCTACTGATAGATGTATTGG - Intergenic
940463724 2:154002027-154002049 AAATCTGCTGGAAGCTCTATTGG + Intronic
940592207 2:155743802-155743824 AAATCTACTGATAGTCATAATGG - Intergenic
940795586 2:158073622-158073644 AAGTCTGCTGCCAGATGTATTGG - Intronic
941256590 2:163239938-163239960 AAATCTACTGATAGTCATATAGG + Intergenic
941402046 2:165043369-165043391 AAATCTGCTGTTAATTTGATAGG + Intergenic
941560054 2:167033666-167033688 AAGTCTGCTGCCAGATGTATTGG - Intronic
941583546 2:167329885-167329907 AAATCTGCTGTTAGTCTGATGGG + Intergenic
942769290 2:179496623-179496645 AAGTCTGCTGGCAGATGTATTGG - Intronic
942811829 2:180008962-180008984 ATTTCTGTTGATAGTTGTAGAGG - Intergenic
943485284 2:188472124-188472146 AATTCTGCTGCCAGATGTATTGG + Intronic
943519325 2:188928447-188928469 AAATCTGCTGAAAGCTGTATTGG + Intergenic
943914991 2:193620435-193620457 AAATCTTCTTATAGTTGGAAGGG + Intergenic
944005092 2:194895378-194895400 AAGTCTGCTGCCAGATGTATTGG + Intergenic
944028961 2:195209205-195209227 TAATTTGCTGAGAGTTTTATTGG + Intergenic
944094608 2:195952294-195952316 AGATCTGCTGTTAGTTCAATGGG + Intronic
944269104 2:197760873-197760895 AAATCTGCTGTTAGTATAATGGG - Intronic
944431920 2:199643402-199643424 AAATCTGCTGTTAATCTTATAGG + Intergenic
944602269 2:201314814-201314836 AAATCTGCTGTTAGTCTGATAGG - Intronic
944616182 2:201463414-201463436 AAGTCTGCTGCAAGATGTATTGG + Intronic
944680765 2:202074657-202074679 GACTCTCCTGAAAGTTGTATGGG + Intronic
945362543 2:208908587-208908609 AAATCTGCTGCTAATTTGATAGG - Intergenic
945371324 2:209021932-209021954 AAATCTGCTGTTAGTCTGATGGG - Intergenic
945801980 2:214444767-214444789 ATATCTGATGAAAGATGTATTGG + Intronic
946197972 2:218049441-218049463 AAGTCTGCTGCCAGATGTATTGG + Intronic
946686461 2:222276526-222276548 AAGTCTGCTGAGAGGTGGATGGG + Intronic
946694147 2:222335086-222335108 AAATCTGCTGTTAGTCTGATGGG - Intergenic
947439511 2:230107141-230107163 AAGTCTGCTGCCAGATGTATTGG + Intergenic
948626454 2:239271918-239271940 ATGTCTGCTGAGACTTGTATTGG - Intronic
1168744004 20:220616-220638 AAGTCTGCTGCTAGATGTATTGG - Intergenic
1168917035 20:1498421-1498443 AAATCTGCTGCCAGATGTATTGG + Intergenic
1168941403 20:1714441-1714463 AAGTCTGCTGTTAGTTTGATAGG - Intergenic
1169587212 20:7098352-7098374 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1169988925 20:11476678-11476700 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1170062942 20:12278229-12278251 AAATCTGCTGCCAGCTGTATTGG - Intergenic
1170183545 20:13560991-13561013 AAATCTGCTTATAATATTATTGG - Intronic
1170215931 20:13891292-13891314 AAATCTGCTGATAATGTTACAGG - Intronic
1170240694 20:14163308-14163330 AAATCTGCTGTTAGTCTGATGGG + Intronic
1170862988 20:20126578-20126600 AAATCTGCTGTTAGTCTGATAGG + Intronic
1171777773 20:29386522-29386544 AAGTCTGCTGTCAGATGTATTGG + Intergenic
1171819534 20:29821715-29821737 AAGTCTGCTGTCAGATGTATTGG + Intergenic
1171898295 20:30831468-30831490 AAGTCTGCTGTCAGATGTATTGG - Intergenic
1173029913 20:39347175-39347197 AAACCTGCTGATATTTGAAAGGG - Intergenic
1173765649 20:45607175-45607197 AAATCCACTGATAATTGTATGGG + Intergenic
1174512513 20:51064935-51064957 TAATCTGCTAAAAGTTGGATTGG + Intergenic
1176703479 21:10089092-10089114 AAATCAGCTGAAAGTAGCATAGG + Intergenic
1177106705 21:16965698-16965720 AAATCTGCTGTTAGTTTAATGGG + Intergenic
1177330943 21:19661657-19661679 AAAACTGCTGATGGTATTATGGG + Intergenic
1177352613 21:19963886-19963908 AAATCCACTGATAGTTATATTGG + Intergenic
1178526398 21:33333138-33333160 AAATCTGCTGTTAGCTGAATGGG - Intronic
1179339659 21:40493016-40493038 GAATCTGCTGCTAGCTTTATTGG - Intronic
1179364612 21:40745438-40745460 AAATCTGCTGAAACTTGCACTGG - Intronic
1180323520 22:11346407-11346429 AAGTCTGCTGTCAGATGTATTGG + Intergenic
1180454744 22:15503794-15503816 AAATCTGCTGTTACTTTGATAGG + Intergenic
1180490915 22:15847792-15847814 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1181717125 22:24739474-24739496 AAGTCTGCTGCCAGATGTATTGG - Intronic
1183326852 22:37199056-37199078 AAACCTGCTGATTGTTGGAGGGG + Intronic
1184055143 22:42042032-42042054 AAATCTGCTGATAGTCTCATAGG + Intronic
1184317211 22:43704156-43704178 AAATCTGCTGATAGTCATGTTGG - Intronic
949583545 3:5414297-5414319 AAATCTGCTGTTAGTCTAATGGG - Intergenic
949793909 3:7824737-7824759 AAATCTGCTGTTAGTCTAATTGG - Intergenic
949799326 3:7885699-7885721 AAATCTGCTGTTAATTTGATAGG - Intergenic
950927597 3:16758291-16758313 AAGTCTGCTGCTGGATGTATTGG + Intergenic
950990403 3:17431687-17431709 AAATATGCTGATAGTTACATTGG + Intronic
951090469 3:18567471-18567493 AAATGTGCTTATAGTGGTTTTGG + Intergenic
951302528 3:21016257-21016279 AAATCTGCTGATAATCTAATAGG + Intergenic
951310100 3:21115408-21115430 AAGTCTGCTGCCAGATGTATTGG + Intergenic
951328341 3:21333173-21333195 AAATCCTCTGAAAGCTGTATTGG - Intergenic
951392806 3:22128238-22128260 AAATCTGCTGCCAGATGCATTGG + Intronic
951436784 3:22674764-22674786 AAGTCTGCTGCCAGATGTATCGG + Intergenic
951682235 3:25306806-25306828 AAACATGCTGATAGTGGGATGGG + Intronic
952016946 3:28969174-28969196 AAATCTGCTGTTAGTCTGATGGG + Intergenic
952486180 3:33812832-33812854 AAAGCTGCTGATGGATGTACTGG + Intronic
953035951 3:39211122-39211144 AAATCTGAAAATAGTTTTATGGG - Intergenic
953115452 3:39988378-39988400 AGGTCTGCTGATAGTTTGATGGG + Intronic
954588751 3:51761547-51761569 AAATATACTGATAGTCTTATGGG + Intergenic
955461463 3:59188359-59188381 AAATCTGCTGTTAATCGGATAGG + Intergenic
955602810 3:60666442-60666464 AAATCTGCTGTCATTTGAATTGG + Intronic
955846939 3:63174016-63174038 AAATCCACTGATAATTATATTGG - Intergenic
956242533 3:67146717-67146739 TATTCTGCAGATAGTTGTTTAGG - Intergenic
956549683 3:70443800-70443822 AAGTCTGCTGCCAGATGTATTGG - Intergenic
956974645 3:74565721-74565743 AAATGTGATGATAATTGTAAAGG + Intergenic
957087425 3:75694241-75694263 AAGTCTGCTGTCAGATGTATTGG - Intergenic
957210756 3:77255338-77255360 ACATCTACTCATAGTTGAATTGG - Intronic
957352954 3:79049676-79049698 AGATCTGCTGTTAGTCTTATGGG - Intronic
957388819 3:79534726-79534748 AAATCTGCCAATAGATGGATTGG - Intronic
957692431 3:83589311-83589333 AAATCTGCTGAACGCTGCATTGG + Intergenic
957709295 3:83834364-83834386 AAATCTACTAATATCTGTATTGG - Intergenic
957735634 3:84198354-84198376 AAATTTGCTGTTAGTCTTATAGG - Intergenic
957975997 3:87446060-87446082 AAATCTGCTGTGAGATGTATTGG + Intergenic
957998183 3:87717683-87717705 AAATCTGCAGAAAGCTGTACTGG - Intergenic
958147293 3:89641865-89641887 AAGTCTGCTTCCAGTTGTATTGG - Intergenic
958203687 3:90359011-90359033 AAATATTCTTATAGTTGAATCGG - Intergenic
958431734 3:94047335-94047357 AACTCTGCTGACAGTTACATGGG - Intronic
958572473 3:95905681-95905703 AAATAAGGTGATAGTAGTATGGG - Intergenic
958598512 3:96262013-96262035 AAATTTGCTGATAGTCTTATGGG - Intergenic
958695345 3:97520567-97520589 AAATCTGCTGTTAGTATGATGGG + Intronic
958756710 3:98258527-98258549 AAGTCTGCTGCCAGATGTATTGG + Intergenic
958950130 3:100407447-100407469 AAATCTGCTGCTAGGCATATTGG + Intronic
958957095 3:100476740-100476762 AAATCTGCTGTTAGTCTGATGGG + Intergenic
959009579 3:101059920-101059942 AAATCTGCTGGTAATTTGATAGG + Intergenic
959124862 3:102278560-102278582 AAGTCTGCTGCCAGATGTATTGG + Intronic
959717265 3:109446266-109446288 AAATCTGCTGCTAGTTGTATTGG - Intergenic
959987562 3:112592790-112592812 AAATCTGCTAATAATCTTATTGG + Intergenic
960185750 3:114636061-114636083 AAATTTGCTGACAGTCTTATGGG - Intronic
960565134 3:119124946-119124968 AAGTCTGCTGCCAGATGTATTGG - Intronic
960688258 3:120315346-120315368 AGGTCTGCTGTTAGTTGGATGGG - Intergenic
961988300 3:131160207-131160229 ACATCTGCTGTTAGTTTGATGGG - Intronic
962237808 3:133723135-133723157 AAATATGCTGATAGTCTGATAGG + Intergenic
962530317 3:136274484-136274506 AAATCTGCTGTTAGTCTGATTGG + Intronic
962628680 3:137253242-137253264 AAGTCTGCTGCAAGGTGTATTGG - Intergenic
962764760 3:138551147-138551169 AAATCTGCTGTTAATCTTATAGG - Intronic
963052795 3:141157189-141157211 AAATATCCTGATACTTGCATTGG + Intergenic
963330723 3:143911739-143911761 AAGTCTGCTGCCAGATGTATGGG - Intergenic
963522365 3:146371680-146371702 AAATCTGCTGTTACTTTGATAGG + Intergenic
963528530 3:146445502-146445524 AAGTCTGCTGCCAGATGTATTGG + Intronic
963758590 3:149261288-149261310 AAATCTGCTGTTAGTCTGATGGG - Intergenic
963763121 3:149305882-149305904 AAGTCTGCTGCCAGATGTATTGG + Intergenic
964226610 3:154410009-154410031 AAATCTGCTGTTAATCTTATAGG - Intronic
964258712 3:154809796-154809818 AAGTCTGCTGACAGATGTATTGG + Intergenic
964274001 3:154988617-154988639 AAATCTGCTGTTAGTGTAATGGG - Intergenic
964350007 3:155793113-155793135 AAGTCTGCTGCCAGATGTATTGG - Intronic
964456513 3:156873859-156873881 AAATCTGCTATTAGTTTGATGGG + Intronic
964552022 3:157895609-157895631 TAAGCTGCTGATATTTGTACTGG - Intergenic
965000763 3:162949624-162949646 AAGTCTGATGTTAGTTTTATAGG - Intergenic
965099775 3:164280301-164280323 AATTCTGCTGCCAGCTGTATTGG - Intergenic
965209374 3:165766111-165766133 AAGTCTGCTGCCAGATGTATTGG + Intergenic
965216719 3:165873586-165873608 AAATCTGCTGTTAATTTGATAGG + Intergenic
965251038 3:166344179-166344201 AAGTCTGCTGAAAGATGTATTGG - Intergenic
965650649 3:170929293-170929315 AAATCCGCTGTTAGTTTGATGGG + Intergenic
965654860 3:170973663-170973685 AAATCTGCTGTTAGTCTGATGGG + Intergenic
966250712 3:177862204-177862226 AAGACTGCTGATAGTCATATTGG + Intergenic
966309614 3:178578156-178578178 AGATCTGCTGTTAGTTTGATGGG - Intronic
966337326 3:178883183-178883205 AAGTCTGCTGCCAGATGTATTGG - Intergenic
966348760 3:179006636-179006658 AAGTCTGCTGCCAGATGTATTGG - Intergenic
966453501 3:180089412-180089434 AAATCGGCTGTAAGATGTATTGG + Intergenic
966468308 3:180257439-180257461 AAATCTGTTGCTAGCTGTACTGG - Intergenic
966538196 3:181058308-181058330 AAATATGCTGATACTTTTCTGGG + Intergenic
966955331 3:184871439-184871461 AAGTCTGCTGATCCCTGTATTGG - Intronic
967599933 3:191374592-191374614 CAATATTCTGATAGTTTTATTGG + Intronic
967779621 3:193421199-193421221 AAATCTGTTGATAGTCTAATGGG - Intronic
970059024 4:12008963-12008985 AAAGTTGGTGATAGATGTATGGG + Intergenic
970791839 4:19867175-19867197 AGATCTGCTGCTAGTTTGATGGG + Intergenic
970885841 4:20986660-20986682 AAATCTGCTGATAGAAATAAAGG - Intronic
970896277 4:21107963-21107985 AAATCTGCTGTTAGTCTGATGGG + Intronic
971665037 4:29472515-29472537 AAGTCTGCTGCCAGATGTATTGG - Intergenic
971838397 4:31799728-31799750 AAGTCTGCTGTCAGATGTATTGG + Intergenic
972218260 4:36921593-36921615 AAATCTGCTGAAAACTGTTTGGG - Intergenic
972278247 4:37579630-37579652 AAGTCTGCTGCCAGATGTATTGG + Intronic
972482170 4:39507340-39507362 GTATCTGCTGATATTTGTTTTGG - Intronic
972934263 4:44112968-44112990 AAGTCTGCTGATAGACATATTGG + Intergenic
972976851 4:44645798-44645820 AAATTTGCTGATTGTTCTAAAGG - Intronic
973082953 4:46017325-46017347 TAATCTTCTGATAAGTGTATAGG + Intergenic
973115782 4:46456753-46456775 AAATCTACTGAAAGCTGTATTGG - Intronic
974023843 4:56714391-56714413 AGATCTGCTGATAGTCTGATGGG - Intergenic
974254384 4:59430272-59430294 AAATCTGCTGTTAGTCTGATGGG - Intergenic
974337411 4:60568398-60568420 ATATCTGCTGATAGATGTATTGG + Intergenic
974597077 4:64028504-64028526 AATTCTGCTGCTAGAGGTATTGG + Intergenic
974848955 4:67382462-67382484 AAATCTGCTGTTAGTCTGATAGG - Intergenic
974893060 4:67905689-67905711 AAGTCTGCTGCCAGATGTATTGG + Intergenic
975067434 4:70085545-70085567 AACTCTGGAGAAAGTTGTATGGG - Intergenic
975190177 4:71451531-71451553 AAATGTGGTGATGGTTTTATGGG + Intronic
975254838 4:72221043-72221065 ATGTCTGTTGATAGTTCTATTGG - Intergenic
975335669 4:73172208-73172230 AAGTCTGCTGCTAGATGTATTGG - Intronic
976106070 4:81618862-81618884 TAATCAGCTCATAGTTTTATTGG + Intronic
976115046 4:81717008-81717030 AGATCTGCTGTTAGTTTGATGGG - Intronic
976123243 4:81805585-81805607 AAATCTGCTGAGGGTTCTGTGGG - Intronic
976161396 4:82203074-82203096 AAGTCTGCTGCCAGATGTATTGG - Intergenic
976556353 4:86454909-86454931 AAATCTGCTGTTAATTTGATAGG - Intronic
976776925 4:88717318-88717340 AAGTCTGCTGAAAGCTGTATTGG + Intergenic
976861678 4:89673068-89673090 AAATCTGCTGTTAGTCTGATGGG - Intergenic
976886268 4:89988437-89988459 AAATCTCCTGCTAGATGTATTGG + Intergenic
977045689 4:92065999-92066021 CAATCTGCTAATAGTTTTATAGG + Intergenic
977185073 4:93926675-93926697 AAGTCTGCTGCCAGATGTATTGG - Intergenic
977252141 4:94701022-94701044 AAATCTGTTTATAGTTATTTAGG + Intergenic
977396876 4:96482621-96482643 AAATCTGCTGCCAGATATATTGG + Intergenic
977514838 4:98008222-98008244 AAGTCTGCTGTTAGTTTGATGGG - Intronic
977741764 4:100492692-100492714 AAGTATGTTGATAGTTGTATTGG - Intronic
977771152 4:100862473-100862495 AAATCTGCTGTTATTTTGATAGG + Intronic
977873449 4:102121877-102121899 AAGTCTGCTGCCAGATGTATTGG + Intergenic
977941006 4:102859266-102859288 AAACCTGCTGAAAGTCTTATAGG + Intronic
977981958 4:103334597-103334619 TTACCTGTTGATAGTTGTATGGG - Intergenic
977985805 4:103381462-103381484 AAGTCTGCTGCCAGCTGTATTGG - Intergenic
978002226 4:103570385-103570407 AAATCTCAAGATAGTTTTATTGG + Intergenic
978112611 4:104980342-104980364 AAGTCTGCTGCCAGATGTATTGG - Intergenic
978205153 4:106072459-106072481 AGATCTGCTGTTAGTTTGATGGG + Intronic
978245038 4:106562455-106562477 AGATCTGCTGTTAGTTTGATTGG + Intergenic
978539036 4:109796136-109796158 AAATCCACTGATAGTTTTATAGG - Intronic
978543450 4:109843641-109843663 GAATCTGCTGGTAGTTCTTTTGG + Intronic
978654932 4:111053344-111053366 AATTCTGCTGCCAGATGTATTGG - Intergenic
978718179 4:111871669-111871691 AAATATGCTGACAAATGTATAGG + Intergenic
978916837 4:114136466-114136488 AAATGTGCTGAAAGTTGTGTTGG + Intergenic
978930150 4:114300855-114300877 AAATCTGCTGATAACTGCACTGG + Intergenic
979043867 4:115836018-115836040 AGATCCGCTGTTAGTTGGATGGG - Intergenic
979111580 4:116763629-116763651 AAGTCTGCTGCCAGATGTATTGG - Intergenic
979159859 4:117446683-117446705 AAATCTGCTGTTAGTCTAATAGG + Intergenic
979365039 4:119812256-119812278 ACATCTGCTGACAGTTTTGTAGG + Intergenic
979373441 4:119916195-119916217 AGATCTGCTGATAGTCTGATGGG - Intergenic
979395234 4:120179544-120179566 AAATCTGCTACCAGATGTATTGG - Intergenic
979461437 4:120989053-120989075 AGATCTGCTGTTAGTTTGATGGG + Intergenic
980375698 4:131945448-131945470 AAATCAGCTGAAAGTAGTATAGG + Intergenic
980413171 4:132448911-132448933 AAGTCTGCTGCCAGATGTATTGG - Intergenic
980443179 4:132873269-132873291 AAGTCTGCTGCCAGATGTATTGG - Intergenic
980503811 4:133689550-133689572 AAATCTGCTGTTAGTCTGATGGG + Intergenic
982190784 4:152853515-152853537 AAATCCACTGATAGTCTTATGGG + Intronic
982352504 4:154431101-154431123 AAATCTGCTGAGATTTTTCTTGG + Intronic
982407286 4:155034489-155034511 AAATCTTCTGAAAGTTGTAGAGG - Intergenic
982615486 4:157635375-157635397 AAGTCTGCTGCCAGATGTATTGG - Intergenic
982825909 4:160003438-160003460 AAATCTGCTGATAGTTTGATGGG - Intergenic
983351426 4:166595367-166595389 AAATTTGCTGTTAGGTGTGTTGG - Intergenic
983544761 4:168951777-168951799 AAATCTGCTGTTAGTCTGATAGG + Intronic
983588120 4:169377525-169377547 AAATCTGCTGTTAGTCTAATGGG - Intergenic
983596121 4:169470482-169470504 AGATCTGCTGTTAGTTCAATGGG + Intronic
983972140 4:173888713-173888735 AAATATGCTGTTAGTTTGATTGG + Intergenic
984054290 4:174907691-174907713 AAATCTGCTGTTAGTCTTATGGG + Intronic
985394589 4:189528878-189528900 AAATCTGCTGTTAGTCTGATAGG + Intergenic
985970250 5:3372066-3372088 AAGTCTGATGATAGGTATATTGG + Intergenic
986548515 5:8926095-8926117 AAGTCTGCTGCCAGATGTATTGG - Intergenic
986654036 5:9992505-9992527 AGATCTGCTGTTAGTTTGATGGG - Intergenic
987129057 5:14843524-14843546 TAATCCCCTGATAGTTGTTTGGG - Intronic
987769223 5:22278489-22278511 AAATCTGCTGAAAGAGGAATAGG + Intronic
988545242 5:32150360-32150382 AAATCTGTTGCTATTTTTATTGG - Intronic
988716097 5:33829715-33829737 AAATCTGCTCTTAGATGTGTAGG - Intronic
988906837 5:35798992-35799014 AAACCTGTTCATAGTTGTAAGGG + Intronic
989265900 5:39473541-39473563 AAAACTGCTGATAGTACCATGGG - Intergenic
989778965 5:45242203-45242225 AAATCAGCTGTTAGTTTGATGGG + Intergenic
989818275 5:45763140-45763162 AAATCTGCTGTTAGTCTAATAGG + Intergenic
989965000 5:50457351-50457373 AGATCTGCTGATAGTCTGATGGG + Intergenic
990899095 5:60730646-60730668 ACATCTGCTGTTAGTTTGATGGG - Intergenic
991208910 5:64082388-64082410 AAGTCTGCTGCCAGATGTATTGG + Intergenic
991517068 5:67449165-67449187 AAATCTTCTGGTAGTTTAATGGG + Intergenic
992309747 5:75483637-75483659 AAGTCTTCTGCTAGATGTATTGG - Intronic
992454048 5:76900092-76900114 AAGTCTGCTGTCAGATGTATTGG + Intronic
992702748 5:79357378-79357400 AAATCTGCTGATTTTTCTGTCGG - Intergenic
993095826 5:83476488-83476510 AAATATGCTGATTGTTACATAGG + Intronic
993257239 5:85606897-85606919 CAATCTGCTGCCAGGTGTATTGG - Intergenic
993381678 5:87216255-87216277 AAATCTGCTATTAGTTTAATGGG + Intergenic
993454795 5:88115525-88115547 AAATCTTCTGAGAGTTATCTGGG + Intergenic
993821680 5:92625732-92625754 AAATCTGCTAGTATTTTTATTGG + Intergenic
994320061 5:98384860-98384882 AAGTCTGCTGTCAGATGTATTGG + Intergenic
994549477 5:101212487-101212509 AAATCTACTGATAATATTATGGG - Intergenic
994636736 5:102353077-102353099 AGATCTGCTGTTAGTTTAATGGG - Intergenic
994660196 5:102643603-102643625 AAGTCTGCTGCCAGATGTATTGG - Intergenic
994793009 5:104256445-104256467 AAATCTGCTTATATTCTTATGGG + Intergenic
994940492 5:106317336-106317358 TATTCTGTTGATAGTTATATTGG + Intergenic
995112036 5:108438958-108438980 AAATCTGCTGTTAGTCTGATGGG - Intergenic
995326041 5:110891422-110891444 AGATCTGCTGTTAGTTGGATGGG + Intergenic
995432059 5:112090504-112090526 AAGTCTGTTGATAGATGTATTGG - Intergenic
995464596 5:112437710-112437732 AGATCTGCTGTTAGTTTGATGGG - Intergenic
995480559 5:112588089-112588111 AGATCTGCTGTTAGTTTGATGGG - Intergenic
995770812 5:115666918-115666940 AAGTCTGCTGCCAGATGTATTGG - Intergenic
995901363 5:117071333-117071355 AGATCTGCTGAGGGCTGTATTGG + Intergenic
995992359 5:118256350-118256372 AATTCTTATGATATTTGTATTGG - Intergenic
996120527 5:119666762-119666784 AAATCTGCTGTTAGTCTGATGGG - Intergenic
996142819 5:119933763-119933785 AAATTTGCTGAGACTTTTATTGG + Intergenic
996159614 5:120146338-120146360 TAATCAGCTCATAGTTCTATGGG + Intergenic
996302521 5:122006252-122006274 AAATTTGCTGCTAGTCTTATTGG + Intronic
996326832 5:122285042-122285064 AAATCTGCTGTTAATTCTATTGG + Intergenic
996451169 5:123626655-123626677 AAGTCTGCTGCTATGTGTATTGG - Intergenic
997003229 5:129786492-129786514 AAGTCTGCTGCCAGATGTATTGG - Intergenic
997060044 5:130489822-130489844 AAGTCTGCTGCCAGGTGTATTGG - Intergenic
997087593 5:130819374-130819396 AAATCTGCTGTTAGTCTGATGGG - Intergenic
997190417 5:131929155-131929177 AAATCCACTCATAGTTTTATGGG + Intronic
998288948 5:140893721-140893743 AAATCTGCTGTTAGTCTGATGGG + Intronic
998895407 5:146793725-146793747 AAATCAGCTGATACATGTTTAGG + Intronic
998982476 5:147720212-147720234 AAATCTGCTGTTAGTCTGATGGG + Intronic
1000113008 5:158127121-158127143 AAATCTGCATATAATTGTGTTGG - Intergenic
1000686786 5:164259616-164259638 AATTCTGCTGATCGTCATATTGG - Intergenic
1000695917 5:164383466-164383488 AAGTCTGCTGCTGGATGTATTGG + Intergenic
1001502777 5:172251552-172251574 AAATCTGCTGCTAGCCATATTGG - Intronic
1002920570 6:1567758-1567780 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1003813610 6:9812390-9812412 AAATCTGCTGTTAGTCTGATGGG - Intronic
1004028179 6:11838976-11838998 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1004305177 6:14494346-14494368 AAACCTGCTGAAATTTTTATTGG + Intergenic
1004624501 6:17362160-17362182 GAAGATGCTGACAGTTGTATCGG - Intergenic
1004843882 6:19616694-19616716 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1005037203 6:21567825-21567847 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1005102238 6:22184572-22184594 AAATCTGCTGTTAGTCTAATAGG + Intergenic
1006050593 6:31340033-31340055 AAATCTGCTGTTAGTCTGATGGG + Intronic
1007983502 6:46183764-46183786 ATATTTCCTCATAGTTGTATTGG - Intergenic
1008185627 6:48387215-48387237 AAATCTGCTATTAGTTTGATAGG + Intergenic
1008193422 6:48488108-48488130 AAATCTGCTAAAAGTTATATTGG - Intergenic
1008751895 6:54745029-54745051 AAATCTGCTGATAGTCTAATGGG + Intergenic
1009298217 6:61981834-61981856 AAATTTCCTTATATTTGTATGGG + Intronic
1009467642 6:63991870-63991892 AAATCTACTGATAGTCTCATGGG - Intronic
1009644462 6:66379560-66379582 AAATCTGCTGTTAATTTGATAGG - Intergenic
1010182101 6:73098537-73098559 AAGTCTGCTGCCAGATGTATTGG - Intronic
1010530369 6:76960616-76960638 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1010676837 6:78755284-78755306 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1010875158 6:81094741-81094763 TTATATGCTGATAGTTATATTGG + Intergenic
1011033399 6:82946292-82946314 AAGTCTGCTGCTAGGTGTATTGG - Intronic
1011103814 6:83756795-83756817 AAGTCTGCTGCCAGGTGTATAGG + Intergenic
1011232413 6:85177905-85177927 AAGTCTGCTGCCAGTTGTATTGG + Intergenic
1011234397 6:85200185-85200207 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1011392124 6:86865755-86865777 AATTCTGCTGATAGTCATATTGG - Intergenic
1011447140 6:87453114-87453136 AAATCTGCTGCCAGATGTATTGG - Intronic
1011500507 6:87983224-87983246 AAATCTGCTGACAGCCATATGGG - Intergenic
1011522982 6:88230030-88230052 AAATGTGCTGCTACCTGTATTGG - Intergenic
1011660479 6:89590061-89590083 AAAAATGATAATAGTTGTATTGG + Intronic
1012028805 6:94031672-94031694 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1012483406 6:99692720-99692742 AAATCTGCTGCCAGATATATTGG - Intergenic
1012516593 6:100068916-100068938 ACATCCACTGATAGATGTATTGG + Intergenic
1012613798 6:101250036-101250058 AAATCCACTGAAAGCTGTATTGG - Intergenic
1012878610 6:104758327-104758349 AGATCTGCTGATAGTCTGATGGG - Intronic
1012940679 6:105411412-105411434 AAGTCTGTTGGTAGATGTATTGG - Intergenic
1013925435 6:115466652-115466674 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1013945419 6:115716802-115716824 AAATATGCTGCTATTTGTCTGGG - Intergenic
1013983737 6:116165197-116165219 AAATCTGCTGTTAGTCTGATAGG + Intronic
1014013462 6:116502653-116502675 AAATCTGCTGTTAGTCTGATGGG - Intronic
1014136946 6:117900671-117900693 AAACCTGCTGAGATTTTTATAGG + Intergenic
1014176854 6:118340904-118340926 AGATCTGCTGATAGTCTGATGGG + Intergenic
1014190357 6:118488839-118488861 AAATCTGCTCATAGTCTTATTGG - Intronic
1014234871 6:118942403-118942425 ACATCTGCTGCCAGATGTATTGG - Intergenic
1014352476 6:120362145-120362167 AGATCTGCTGTTAGTCTTATGGG + Intergenic
1014405980 6:121051497-121051519 AAAACACCTGATAGTTTTATAGG + Intergenic
1014692624 6:124579865-124579887 AAACCTGCTGCCAGATGTATTGG - Intronic
1014737491 6:125111419-125111441 AAATCTGCTGATAGTCTCATGGG + Intergenic
1015302150 6:131666215-131666237 AAACCTGCTGATAGTTTTATAGG + Intronic
1015392314 6:132696594-132696616 AAATCTGCCGATAATCTTATTGG - Intronic
1015578582 6:134699757-134699779 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1015829875 6:137357465-137357487 AAATCTGCAGAAAGATGTAATGG + Intergenic
1016005845 6:139088785-139088807 AAATCTGCTGTTAGTCTGATGGG + Intergenic
1016138791 6:140582501-140582523 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1016185553 6:141194251-141194273 AAGTCTGCTGACAGATGTATTGG + Intergenic
1016289812 6:142516982-142517004 AAATCTGCTGTTAATCCTATAGG + Intergenic
1016332271 6:142965951-142965973 AAATAGGTTGTTAGTTGTATAGG + Intergenic
1016496902 6:144674006-144674028 AAATCTGCTGTTAATCTTATAGG + Intronic
1016855613 6:148667675-148667697 CAATCTACTGATATCTGTATTGG + Intergenic
1018613789 6:165665855-165665877 AAATATACTTATGGTTGTATAGG - Intronic
1018755432 6:166844549-166844571 AAATCTGCTGTTAATCTTATAGG - Intronic
1018850305 6:167583517-167583539 AGGTCTGCTGATAGCTGTTTGGG - Intergenic
1019009771 6:168834779-168834801 AAATATAGTGATAGTTGTGTGGG + Intergenic
1019112571 6:169727920-169727942 AAATCAGCTGACAGTTGTGTAGG + Intergenic
1019872951 7:3782597-3782619 AAATCCACTGATGGTAGTATTGG - Intronic
1020519802 7:9171738-9171760 AACTCTGCTGCTAGATGTATTGG + Intergenic
1020573202 7:9891984-9892006 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1020613077 7:10425585-10425607 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021081684 7:16372327-16372349 AAATCTGCTGTTAGTCTAATAGG - Intronic
1021109411 7:16677009-16677031 AAATCTGCTGATCATGGTAAAGG - Intronic
1021130815 7:16911552-16911574 AAATCTGCTGCCAGATGTGTTGG + Intergenic
1021363356 7:19745261-19745283 AAATCTGCAGTTGGTTGAATTGG + Intronic
1021499355 7:21312970-21312992 AAATCAGGAGATAGTTGAATAGG + Intergenic
1021795729 7:24252167-24252189 AAATCTGCTGATGATCATATTGG - Intergenic
1022061292 7:26798219-26798241 AAGTCTGCTGCCAGATGTATTGG - Intronic
1022152307 7:27620389-27620411 AAATCTTCTGTTAGTCTTATGGG - Intronic
1022985824 7:35652498-35652520 AAATCTGCTGATAGTCTGCTGGG - Intronic
1023102357 7:36731785-36731807 AAATCTGCTGAAAGCCATATTGG + Intergenic
1023144529 7:37136502-37136524 AAATCTGCTGTTAATTTGATAGG - Intronic
1023208772 7:37780754-37780776 AAATCTGCTGCCAGGTGTATTGG + Intronic
1024015410 7:45309931-45309953 AAATCTGCTGTTAGTCTCATGGG + Intergenic
1024017891 7:45334629-45334651 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1024413204 7:49071135-49071157 AAATCTGTTGAGAATTGTTTGGG + Intergenic
1024414790 7:49094161-49094183 TAATCTCCTGATAGGTGTATAGG + Intergenic
1024498509 7:50073687-50073709 AAGTCTGCTGCCAGATGTATTGG - Intronic
1024897209 7:54273922-54273944 AAATCTGCAGATAGTCATATTGG + Intergenic
1025577682 7:62668622-62668644 AAATCTGCTGTTAGTCTGATGGG - Intergenic
1025579472 7:62693630-62693652 AAATCTGCAAATAGATATATGGG + Intergenic
1025972176 7:66336885-66336907 ATATCTGCTGAAAGCTCTATTGG - Intronic
1026209491 7:68290910-68290932 AAATGTTTTGCTAGTTGTATGGG + Intergenic
1026713027 7:72759661-72759683 AAATCTGCTGACTTTTCTATTGG + Intronic
1027405155 7:77852936-77852958 AAGTCTGCTGCCAGATGTATTGG + Intronic
1027448431 7:78301723-78301745 AAAGCTGCTGAGATTGGTATTGG - Intronic
1027609791 7:80346467-80346489 GAATTTGGTGAAAGTTGTATTGG + Intergenic
1027826316 7:83120627-83120649 AAGTCTGCTGCCAGATGTATTGG - Intronic
1028226029 7:88253812-88253834 AAATCTGCTGATAGTCTAATGGG + Intergenic
1028284495 7:88979532-88979554 AAGCCTGCTGACAGATGTATTGG + Intronic
1028339218 7:89696864-89696886 AAATCTGCTGCTAGATGCATTGG - Intergenic
1028625943 7:92876948-92876970 AAATCTGCTGATAGCTGCATTGG - Intergenic
1028929295 7:96395653-96395675 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1028972779 7:96877009-96877031 AATTCTGCTGCAAGATGTATTGG - Intergenic
1030517497 7:110556715-110556737 AAGTCTACTGATAGTCTTATGGG + Intergenic
1030599251 7:111573735-111573757 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1030779886 7:113587348-113587370 AAATGGGCTGATAATTGAATTGG + Intergenic
1031087517 7:117318188-117318210 AAATATGCTCATAGATGAATAGG - Intronic
1031238922 7:119213633-119213655 AAATCTGCTGATAGCCTTATTGG + Intergenic
1031566068 7:123298250-123298272 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1032309368 7:130769012-130769034 AAATCTGCTGATGGTCTTATGGG - Intergenic
1032603868 7:133328781-133328803 AGATCTGCTGTTAGTTTGATGGG + Intronic
1032939369 7:136770609-136770631 AAGTCTGCTGACAGATGTATTGG - Intergenic
1033495706 7:141892828-141892850 AAATAAGCTGATAGTTGCTTAGG - Intergenic
1033623051 7:143079357-143079379 AAATCTGCTGTTAATTTGATAGG - Intergenic
1033669139 7:143473141-143473163 AAAATTGTTGATAGTTTTATGGG - Intergenic
1033841842 7:145384912-145384934 AAATCTGTTGTTAGTTTAATAGG + Intergenic
1035551372 8:529727-529749 AAATCTGCTGATAATCTTATGGG + Intronic
1037244610 8:16818734-16818756 AAATCTGTTGAAATTTTTATTGG - Intergenic
1037488281 8:19371424-19371446 AAGTCTGCTGCTGGGTGTATTGG + Intronic
1037596726 8:20360550-20360572 CAATCTGCTGATAATGGTCTTGG + Intergenic
1038233394 8:25727617-25727639 AGATCTGCTGTTAGCTGAATGGG + Intergenic
1038273977 8:26104198-26104220 AAGTCTGCTGACATTTTTATTGG - Intergenic
1038977240 8:32713548-32713570 AAATCTGATGGTGGATGTATGGG - Intronic
1039631569 8:39117384-39117406 AACTCTGCTGATATTTTTATTGG + Intronic
1039641640 8:39228960-39228982 AAATCTGCTGATAATCTGATAGG - Intronic
1039646370 8:39288764-39288786 AAATCTGCTGATAGTTGTATTGG + Intergenic
1039793546 8:40894006-40894028 AAATCTGTTAATAGTTGGAAAGG - Intronic
1040090908 8:43397703-43397725 AAATCTGCTGTTAGTCCAATGGG + Intergenic
1040503166 8:48022991-48023013 AAGTCTGCTGCTAGGTATATTGG + Intronic
1041416208 8:57611245-57611267 AATTCTGCTGCCAGATGTATTGG - Intergenic
1042756333 8:72216650-72216672 AAATTTGCTGATAATCATATTGG - Intergenic
1042898566 8:73697019-73697041 AAGTCTGCTGCCAGTTGTATTGG - Intronic
1043042257 8:75277690-75277712 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1043144878 8:76640634-76640656 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1043288847 8:78570323-78570345 AAATCTGCTGTCATTTGAATTGG - Intronic
1043367077 8:79544969-79544991 AAATCTGCTGCCAGAGGTATTGG - Intergenic
1044362195 8:91300044-91300066 AAACTTGCTGATACTTTTATTGG + Intronic
1044576790 8:93778717-93778739 AAATCTGCTGTTAGTCTGATGGG + Intronic
1044796572 8:95905952-95905974 AAATGTGTCGATAGTTTTATTGG - Intergenic
1044878161 8:96693497-96693519 AAGTCTGCTGCCAGATGTATTGG - Intronic
1045041095 8:98225552-98225574 AAATCTGCTGCCAGATGTATCGG + Intronic
1045067449 8:98461844-98461866 AAATCTGCTGTTAGTCTGATAGG + Intronic
1045683318 8:104685965-104685987 AAAGCTGTTGATACTTGTACTGG - Intronic
1046150164 8:110213064-110213086 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1046266574 8:111838095-111838117 AAATCTGCTGCTAACTATATTGG - Intergenic
1046369418 8:113282038-113282060 AAATCTGCTGTTAATTTGATAGG + Intronic
1047077152 8:121416877-121416899 AAATCTGCTGTCACTTGAATTGG - Intergenic
1047342583 8:123997372-123997394 AAGTCTCCTGACAGATGTATTGG + Intronic
1047937144 8:129793430-129793452 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1048411493 8:134178743-134178765 AAATCTGCTCATAATCTTATTGG + Intergenic
1048540471 8:135337156-135337178 AGATCTGCTGTTAGTCGGATGGG - Intergenic
1048673567 8:136751008-136751030 AAATCTGCTGATAGTAGAATTGG + Intergenic
1050121745 9:2315283-2315305 AATTCTGCTGCAAGATGTATTGG + Intergenic
1050133754 9:2440208-2440230 AAATCTGCTGTTAATCTTATAGG + Intergenic
1050197945 9:3108029-3108051 AGATCTGCTGTTAGTCGGATGGG - Intergenic
1050406668 9:5315730-5315752 AAATTTGCTGATAGTCTAATGGG - Intergenic
1050956921 9:11675384-11675406 AAATCTGCTGATAGTCTTATGGG + Intergenic
1050973722 9:11910769-11910791 AGATCTGCTGTTAGTCTTATGGG + Intergenic
1051232680 9:14968718-14968740 AGATCTGCTGTTAGTCTTATGGG - Intergenic
1051240262 9:15047467-15047489 AAATCTACTTATAGTTTTGTGGG - Intergenic
1052155252 9:25179465-25179487 AAATCTGCTGATAGTTTTAGAGG - Intergenic
1052258569 9:26488879-26488901 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1052525263 9:29609369-29609391 AAGTCTGCTGCTAGTCATATTGG - Intergenic
1052585899 9:30426997-30427019 AGATCTGCTGCCAGATGTATTGG - Intergenic
1053040273 9:34864432-34864454 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1053204859 9:36177412-36177434 AAATCTGCTGCCAGAAGTATTGG - Intergenic
1053750872 9:41253266-41253288 AAGTCTGCTGTCAGATGTATTGG - Intergenic
1053753383 9:41278676-41278698 AAATCTGCTGTTAGTTTGATAGG + Intergenic
1054256390 9:62817608-62817630 AAGTCTGCTGTCAGATGTATTGG - Intergenic
1054258911 9:62843039-62843061 AAATCTGCTGTTAGTTTGATAGG + Intergenic
1054332872 9:63777001-63777023 AAATCTGCTGTTAGTTTGATAGG - Intergenic
1054334921 9:63798005-63798027 AAGTCTGCTGTCAGATGTATTGG + Intergenic
1055304218 9:74911999-74912021 AATTCTGCTGTTAGTCGAATGGG - Intergenic
1055910998 9:81351172-81351194 AAGTCTGCTGCTAGATATATCGG - Intergenic
1056007546 9:82288087-82288109 AAGTCTGCTGATAGATGTATTGG - Intergenic
1056176373 9:84040810-84040832 AGATCTGCTGTTAGTTTGATGGG + Intergenic
1056906298 9:90651439-90651461 AACTCTGCTGATAATCTTATTGG - Intergenic
1057278379 9:93690007-93690029 GAATCTGCTGTTATTTGAATTGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057318301 9:93987017-93987039 AAGTCTGCTGTTAGTTTGATGGG - Intergenic
1058013310 9:100002618-100002640 AAAACTGCTGCTAGCTGTACTGG + Intronic
1058232692 9:102448624-102448646 AAATCTGATGCCAGATGTATTGG - Intergenic
1058546413 9:106064905-106064927 AAAGTTGCTCATAGTTGCATTGG - Intergenic
1058784409 9:108373112-108373134 AAATCTGCTGTTAATTTGATAGG + Intergenic
1058821159 9:108730701-108730723 AACTCTGCTGCCAGATGTATTGG - Intergenic
1062297800 9:135842619-135842641 AGATCTGCTGTTAGTTTGATGGG - Intronic
1062692914 9:137853902-137853924 AAATCCGCTGTTAGTTGAATAGG + Intronic
1062739574 9:138161428-138161450 AAGTCTGCTGTCAGATGTATTGG - Intergenic
1202788515 9_KI270719v1_random:59191-59213 AAATCAGCTGAAAGTAGCATAGG + Intergenic
1202799868 9_KI270719v1_random:165312-165334 AAATCTGCTGTTAGTTTGATAGG - Intergenic
1203371200 Un_KI270442v1:306981-307003 AAGTCTGCTGTCAGATGTATTGG + Intergenic
1186751513 X:12626456-12626478 AAATCTGCTGATAGTTGTATTGG - Intronic
1187292762 X:17971103-17971125 AAATCTGCTGATAGGAGTTGTGG - Intergenic
1187773446 X:22729201-22729223 AAATCTGCTGTTAATTTGATAGG + Intergenic
1188071575 X:25724890-25724912 AAGTCTGCTGCCAGGTGTATTGG + Intergenic
1188078314 X:25806176-25806198 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1188740731 X:33777086-33777108 AAATCCACTGATGGTTTTATGGG + Intergenic
1188746087 X:33846114-33846136 AAATCTGCTGATAGTCTAAGGGG + Intergenic
1188915268 X:35903213-35903235 AAATCTGCTGTTAGTCTGATGGG + Intergenic
1188926214 X:36047859-36047881 AAATCTGCTGATGATTGAAATGG - Intronic
1188996288 X:36889473-36889495 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1189875861 X:45435049-45435071 AAATCTGCTGTCATTTGAATTGG + Intergenic
1190038059 X:47044315-47044337 AAGTCTGCTGCTAGATGTATTGG - Intronic
1190374135 X:49773019-49773041 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1190919374 X:54837632-54837654 AAGTCTGCTGACAGAAGTATTGG + Intergenic
1191180445 X:57557517-57557539 AAATCTGCTGTTAATCTTATAGG - Intergenic
1191600816 X:63003766-63003788 AAGTCCACTGACAGTTGTATTGG + Intergenic
1191800083 X:65068982-65069004 AAGTCTGCTGTCAGATGTATTGG + Intergenic
1191800572 X:65074335-65074357 AAATCTACTGATAGTTTTATGGG + Intergenic
1192002663 X:67171511-67171533 AAGTCTGCTGACAGTCGTATTGG + Intergenic
1192256427 X:69464179-69464201 AAATCTGCTGTAATTTGAATTGG + Intergenic
1192633866 X:72800137-72800159 AAATCCACTGAAAGCTGTATTGG + Intronic
1192647844 X:72920664-72920686 AAATCCACTGAAAGCTGTATTGG - Intronic
1192715216 X:73633388-73633410 AAATCTGCTGATTTTCTTATTGG + Intronic
1192878292 X:75255131-75255153 AAATCTGCTGTTAGTCTGATAGG - Intergenic
1192930706 X:75803103-75803125 AAATCTGCTGTTAATTTGATAGG - Intergenic
1192959464 X:76112012-76112034 AAGTCTGCTGTCAGATGTATTGG - Intergenic
1192973611 X:76259720-76259742 AGATCTGCTGATAGTCTGATGGG + Intergenic
1192986141 X:76400419-76400441 AACCTTGCTGATAGTTGTATTGG - Intergenic
1192997327 X:76526195-76526217 AGATCTGCTGTTAGTCTTATGGG + Intergenic
1193065572 X:77255806-77255828 AGATCTGCTGTTAGTTTGATGGG - Intergenic
1193078112 X:77376614-77376636 AAATCTGCTGTTAATCTTATGGG - Intergenic
1193247515 X:79246117-79246139 AAATTTGCTGTCAGATGTATTGG - Intergenic
1193366468 X:80639495-80639517 AAATCTGCTGTTAATCTTATAGG - Intergenic
1193396753 X:80992481-80992503 AAGTCTGCTGCCAGGTGTATTGG - Intergenic
1193409213 X:81142507-81142529 AAATCTGCTGCAAGATTTATTGG - Intronic
1193548902 X:82865216-82865238 AAGTCTGCTGATAGCCTTATGGG - Intergenic
1193561632 X:83024337-83024359 AAAACTGCTGCCAGGTGTATTGG - Intergenic
1193563223 X:83046138-83046160 AAGTCTGCTGCTAGACGTATTGG + Intergenic
1193670465 X:84378040-84378062 AAGTCTGCTGCCAGATGTATTGG - Intronic
1193673734 X:84420777-84420799 AAGTCTGCTGACAGATGTATTGG - Intronic
1193691798 X:84655215-84655237 AACTCTGCTGCCAGATGTATTGG + Intergenic
1193742530 X:85234079-85234101 AAGTCTTCTGACAGATGTATTGG - Intergenic
1193785858 X:85759282-85759304 AAATCTGCTGTTAATTTGATAGG + Intergenic
1193887133 X:86996060-86996082 AAGTCTGCTGTCAGATGTATTGG - Intergenic
1193911790 X:87315391-87315413 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1194006873 X:88505655-88505677 AAGTCTGCTGATAGACATATTGG - Intergenic
1194136744 X:90152964-90152986 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1194150931 X:90324458-90324480 TAATCTGCTCATGGTTTTATGGG + Intergenic
1194209615 X:91055644-91055666 AATTTTGGTGATAGTTTTATGGG + Intergenic
1194264819 X:91741454-91741476 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1194322976 X:92475528-92475550 AAATGTGCTGCCAGATGTATTGG + Intronic
1194457362 X:94121827-94121849 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1194500448 X:94675512-94675534 AAGTCTGCTGAGAGATGTACTGG + Intergenic
1194538847 X:95145068-95145090 AAATCTGCTGAAAGTAAGATTGG + Intergenic
1194546553 X:95241560-95241582 AAGTCTGCTCCTAGATGTATTGG - Intergenic
1194568650 X:95524516-95524538 AAATCTGCTGCCAGATGTATTGG - Intergenic
1194611163 X:96047564-96047586 AAAATTGCTGATATTTGTATTGG - Intergenic
1194892379 X:99396541-99396563 AAATCTACTGCCAGATGTATTGG + Intergenic
1195122755 X:101773396-101773418 AAGTCTGTTGCTAGATGTATTGG + Intergenic
1195493338 X:105499925-105499947 TAATCTGCTGATGGATGTTTAGG - Intronic
1195848959 X:109262664-109262686 AACTCTCCTGCTAGATGTATTGG + Intergenic
1195911682 X:109894791-109894813 AAATCTGCTGTAATTTGAATTGG + Intergenic
1196214338 X:113033554-113033576 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1196253180 X:113485930-113485952 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1196370179 X:114968852-114968874 AACCCTGCTGATATTTGTATTGG - Intergenic
1196471176 X:116030123-116030145 AAGTCTGGTGGTAGCTGTATTGG + Intergenic
1196561401 X:117153446-117153468 AGATCTGCTGTTAGTCTTATGGG - Intergenic
1196639434 X:118040845-118040867 AAGCCTGCTGACAGATGTATTGG - Intronic
1196998619 X:121413137-121413159 AATTTTGTTGATAGTTGTTTTGG + Intergenic
1197139437 X:123099825-123099847 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1197303212 X:124806591-124806613 AAGTTTGCTGCTAGGTGTATTGG - Intronic
1197390858 X:125862181-125862203 AAGTCTGCTGTTAGTTTGATGGG - Intergenic
1197487542 X:127072713-127072735 AAATTTGCTGTGAGGTGTATTGG + Intergenic
1197493659 X:127151427-127151449 AAATCTGCTGTTAGTCTGATAGG + Intergenic
1197514503 X:127409406-127409428 AATTCTGCTGATGGAAGTATTGG + Intergenic
1197623353 X:128777437-128777459 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1197677230 X:129343200-129343222 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1198148751 X:133886841-133886863 AAATCTGCTGATGGATATTTAGG + Intronic
1198180059 X:134198503-134198525 ACCTCTGCTGAGAGTTGGATTGG + Intergenic
1198697031 X:139353301-139353323 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1198836683 X:140813389-140813411 AAATCTGCTGTTAGTCTGATAGG + Intergenic
1199134250 X:144231791-144231813 AAATCTACTGTTAGTTCAATGGG + Intergenic
1199145747 X:144364179-144364201 AAGTCTGCTGCCAGCTGTATTGG - Intergenic
1199317048 X:146393260-146393282 AAATCTGCTGCTAGACATATTGG + Intergenic
1199442862 X:147888423-147888445 AAATCTGCTGCCAGATGTATTGG + Intergenic
1199908951 X:152263864-152263886 AAGTCTGCTGCCAGATGTATTGG - Intronic
1200345595 X:155443805-155443827 AAATCTGCTGTTAGTCTAATGGG - Intergenic
1200482490 Y:3722914-3722936 AAGTCTGCTGCCAGATGTATTGG - Intergenic
1200497297 Y:3901217-3901239 TAATCTGCTCATGGTTTTATGGG + Intergenic
1200581966 Y:4961900-4961922 AAGTCTGCTGCCAGATGTATTGG + Intergenic
1200631076 Y:5588688-5588710 AAATGTGCTGCCAGATGTATTGG + Intronic
1200702463 Y:6413802-6413824 CAATCTGCTGAGGGGTGTATGGG - Intergenic
1200938911 Y:8762358-8762380 CAATCTGCTGAGAAGTGTATTGG - Intergenic
1201031648 Y:9750896-9750918 CAATCTGCTGAGGGGTGTATGGG + Intergenic
1201067141 Y:10108093-10108115 AAGTCTGCTGTCAGATGTATTGG - Intergenic
1201384736 Y:13426615-13426637 AAATTTGCTTAAAGTTATATTGG - Intronic
1201498077 Y:14611651-14611673 ATATCTGCTGTTAGTTTGATAGG + Intronic
1201908879 Y:19113280-19113302 AAATCTGCTGTTAGTCTGATTGG + Intergenic
1202043800 Y:20715650-20715672 AAATCTGCTGTTAATCTTATAGG - Intergenic
1202094918 Y:21239835-21239857 AGATCTGCTGTTAGTTGTACAGG + Intergenic
1202333236 Y:23777372-23777394 AAATCTGCTGTTAGTCTGATGGG + Intergenic
1202340762 Y:23863260-23863282 AAATCTGCTGATTATTGTTGAGG + Intergenic
1202530004 Y:25806822-25806844 AAATCTGCTGATTATTGTTGAGG - Intergenic
1202537533 Y:25892691-25892713 AAATCTGCTGTTAGTCTGATGGG - Intergenic