ID: 1039656331

View in Genome Browser
Species Human (GRCh38)
Location 8:39412027-39412049
Sequence CATCAATGGCAGTCAGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039656325_1039656331 21 Left 1039656325 8:39411983-39412005 CCTGTGTGATGAACCACCAGTTA No data
Right 1039656331 8:39412027-39412049 CATCAATGGCAGTCAGGCAATGG No data
1039656326_1039656331 8 Left 1039656326 8:39411996-39412018 CCACCAGTTAACTAAAGTAGCCT No data
Right 1039656331 8:39412027-39412049 CATCAATGGCAGTCAGGCAATGG No data
1039656324_1039656331 25 Left 1039656324 8:39411979-39412001 CCAACCTGTGTGATGAACCACCA No data
Right 1039656331 8:39412027-39412049 CATCAATGGCAGTCAGGCAATGG No data
1039656327_1039656331 5 Left 1039656327 8:39411999-39412021 CCAGTTAACTAAAGTAGCCTTGA No data
Right 1039656331 8:39412027-39412049 CATCAATGGCAGTCAGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039656331 Original CRISPR CATCAATGGCAGTCAGGCAA TGG Intergenic
No off target data available for this crispr