ID: 1039657984

View in Genome Browser
Species Human (GRCh38)
Location 8:39431112-39431134
Sequence AAAAATAACCCCATTTAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039657984_1039657985 -4 Left 1039657984 8:39431112-39431134 CCAATTTAAATGGGGTTATTTTT No data
Right 1039657985 8:39431131-39431153 TTTTTGCCTGTGAATTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039657984 Original CRISPR AAAAATAACCCCATTTAAAT TGG (reversed) Intergenic
No off target data available for this crispr