ID: 1039664892

View in Genome Browser
Species Human (GRCh38)
Location 8:39514572-39514594
Sequence GGCAATAGCCAAAGTGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039664892_1039664897 21 Left 1039664892 8:39514572-39514594 CCTTACCCACTTTGGCTATTGCC No data
Right 1039664897 8:39514616-39514638 ATACAAAGTCACAACTTTCTGGG No data
1039664892_1039664896 20 Left 1039664892 8:39514572-39514594 CCTTACCCACTTTGGCTATTGCC No data
Right 1039664896 8:39514615-39514637 TATACAAAGTCACAACTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039664892 Original CRISPR GGCAATAGCCAAAGTGGGTA AGG (reversed) Intergenic
No off target data available for this crispr