ID: 1039667729

View in Genome Browser
Species Human (GRCh38)
Location 8:39553965-39553987
Sequence ATTTTCCACTAAAAGAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039667728_1039667729 0 Left 1039667728 8:39553942-39553964 CCAGATTACACTTTTTCAATATT No data
Right 1039667729 8:39553965-39553987 ATTTTCCACTAAAAGAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039667729 Original CRISPR ATTTTCCACTAAAAGAAATA TGG Intergenic
No off target data available for this crispr