ID: 1039667945

View in Genome Browser
Species Human (GRCh38)
Location 8:39556828-39556850
Sequence GAATGTGAGCAACTGCTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039667945_1039667946 -2 Left 1039667945 8:39556828-39556850 CCATTAAGCAGTTGCTCACATTC No data
Right 1039667946 8:39556849-39556871 TCTCCCTTCCCCTCAGACCCTGG No data
1039667945_1039667955 26 Left 1039667945 8:39556828-39556850 CCATTAAGCAGTTGCTCACATTC No data
Right 1039667955 8:39556877-39556899 GCCCCTCTGTGTTGTCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039667945 Original CRISPR GAATGTGAGCAACTGCTTAA TGG (reversed) Intergenic
No off target data available for this crispr