ID: 1039669551

View in Genome Browser
Species Human (GRCh38)
Location 8:39581026-39581048
Sequence CCATCTTAGCAAGAGACGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039669551_1039669560 19 Left 1039669551 8:39581026-39581048 CCATCCGTCTCTTGCTAAGATGG No data
Right 1039669560 8:39581068-39581090 AGAGCATTACACATGGGTTAGGG No data
1039669551_1039669557 12 Left 1039669551 8:39581026-39581048 CCATCCGTCTCTTGCTAAGATGG No data
Right 1039669557 8:39581061-39581083 ATATCGCAGAGCATTACACATGG No data
1039669551_1039669559 18 Left 1039669551 8:39581026-39581048 CCATCCGTCTCTTGCTAAGATGG No data
Right 1039669559 8:39581067-39581089 CAGAGCATTACACATGGGTTAGG No data
1039669551_1039669558 13 Left 1039669551 8:39581026-39581048 CCATCCGTCTCTTGCTAAGATGG No data
Right 1039669558 8:39581062-39581084 TATCGCAGAGCATTACACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039669551 Original CRISPR CCATCTTAGCAAGAGACGGA TGG (reversed) Intergenic
No off target data available for this crispr