ID: 1039669558

View in Genome Browser
Species Human (GRCh38)
Location 8:39581062-39581084
Sequence TATCGCAGAGCATTACACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039669556_1039669558 9 Left 1039669556 8:39581030-39581052 CCGTCTCTTGCTAAGATGGGGGC No data
Right 1039669558 8:39581062-39581084 TATCGCAGAGCATTACACATGGG No data
1039669547_1039669558 19 Left 1039669547 8:39581020-39581042 CCCCTCCCATCCGTCTCTTGCTA No data
Right 1039669558 8:39581062-39581084 TATCGCAGAGCATTACACATGGG No data
1039669550_1039669558 14 Left 1039669550 8:39581025-39581047 CCCATCCGTCTCTTGCTAAGATG No data
Right 1039669558 8:39581062-39581084 TATCGCAGAGCATTACACATGGG No data
1039669548_1039669558 18 Left 1039669548 8:39581021-39581043 CCCTCCCATCCGTCTCTTGCTAA No data
Right 1039669558 8:39581062-39581084 TATCGCAGAGCATTACACATGGG No data
1039669546_1039669558 28 Left 1039669546 8:39581011-39581033 CCTCGGTCTCCCCTCCCATCCGT No data
Right 1039669558 8:39581062-39581084 TATCGCAGAGCATTACACATGGG No data
1039669551_1039669558 13 Left 1039669551 8:39581026-39581048 CCATCCGTCTCTTGCTAAGATGG No data
Right 1039669558 8:39581062-39581084 TATCGCAGAGCATTACACATGGG No data
1039669549_1039669558 17 Left 1039669549 8:39581022-39581044 CCTCCCATCCGTCTCTTGCTAAG No data
Right 1039669558 8:39581062-39581084 TATCGCAGAGCATTACACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039669558 Original CRISPR TATCGCAGAGCATTACACAT GGG Intergenic
No off target data available for this crispr