ID: 1039672127

View in Genome Browser
Species Human (GRCh38)
Location 8:39613056-39613078
Sequence GCATGCATGGCAGCAGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 5, 3: 15, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039672127_1039672131 12 Left 1039672127 8:39613056-39613078 CCTGTTGCTGCTGCCATGCATGC 0: 1
1: 0
2: 5
3: 15
4: 192
Right 1039672131 8:39613091-39613113 CAACATGCCGCTACCACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039672127 Original CRISPR GCATGCATGGCAGCAGCAAC AGG (reversed) Intronic
900668918 1:3837204-3837226 CCATGCATGGGAACAGCACCTGG + Intronic
900876929 1:5349459-5349481 GACTCCATGGCACCAGCAACAGG + Intergenic
901705752 1:11071729-11071751 GCATGCTGAGCAGCAGCAAGTGG - Intronic
902648677 1:17822471-17822493 GTGAGCATGGCAGCAGCTACAGG - Intronic
903543998 1:24112255-24112277 GCCTGCTGGGCAGCAGCGACAGG + Intergenic
904126155 1:28240724-28240746 GCATACATGACAGAATCAACCGG - Intronic
904624426 1:31794050-31794072 GCGTGCAGTTCAGCAGCAACAGG - Intronic
907148439 1:52258873-52258895 GCAAGCAAGGGAGCAGCAAATGG - Intronic
907558901 1:55370214-55370236 GCATGCATGGCTGAGGCAAATGG + Intergenic
910276020 1:85449772-85449794 GAAAGCATGGCAGCAGGAACAGG + Intronic
911539772 1:99144678-99144700 GCATCCATAGCAGCAACAATTGG + Intergenic
912498638 1:110107320-110107342 GCAGGCAGGGGAGCAGCACCAGG - Intergenic
916586492 1:166154249-166154271 CCATGCATGCCATCAGCACCAGG + Intronic
917872484 1:179254421-179254443 GAATTCATTGCAGCAGCAATAGG + Intergenic
918583105 1:186155344-186155366 GCATGCATGGCAATAGTAAAAGG - Intronic
922645546 1:227282505-227282527 GCACACACTGCAGCAGCAACAGG + Intronic
922799985 1:228360751-228360773 GCCACCATGGCAGCAGCATCAGG - Intronic
923405067 1:233651787-233651809 AAATGCATGGCAGCAGGAGCTGG + Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
924743234 1:246809842-246809864 ACATGAATGCCAGCAGCAGCCGG - Intergenic
1066256283 10:33682028-33682050 ACAAGCATGGCTGCAGCAGCTGG - Intergenic
1069634944 10:69919277-69919299 GCAGGCATGCCAGCTGCAGCAGG + Intronic
1069975583 10:72210098-72210120 ACAAGCATGGCACCAGCATCTGG - Intronic
1070675533 10:78409075-78409097 GCCTGCTTGGCACCAGCACCTGG - Intergenic
1071974933 10:90945902-90945924 GCAGGCATGGCAGTTGCAGCTGG - Intergenic
1074260168 10:111845700-111845722 GCAAGCATGGGACCAGCATCTGG + Intergenic
1075019561 10:118941549-118941571 CTATGAATGGCAGCAGCAGCTGG - Intergenic
1076203032 10:128573119-128573141 ACAGGCAGGGCAGCAGCACCGGG + Intergenic
1076276451 10:129203382-129203404 TCTTACATGGCAGCAGCAGCAGG - Intergenic
1077410923 11:2403541-2403563 GCTTCCATGGCAGCAGGAAGCGG + Exonic
1081070877 11:38606945-38606967 GCCTGAATGGGAGCAGCAATGGG - Intergenic
1081324677 11:41729482-41729504 TCTTACATGGCAGCAGCAAGAGG - Intergenic
1082639983 11:55647447-55647469 TAATTCATTGCAGCAGCAACAGG + Intergenic
1082814566 11:57499602-57499624 GCGTGCGTGGCAACAGCAGCTGG + Intronic
1083310065 11:61779485-61779507 CCCTGCATGGCTGCAGCAAGAGG - Exonic
1086460435 11:87000334-87000356 GAATGCATGGCTGCAGAGACAGG - Intergenic
1087151711 11:94866063-94866085 CCATCCATAGCAGCAGCTACTGG + Exonic
1088626949 11:111736337-111736359 GCATTCATGGCATGAGCAGCTGG + Intronic
1090265542 11:125350948-125350970 GCCTGCCTGGTAGCAGCACCGGG - Intronic
1092226343 12:6750547-6750569 GCAGGCATGACAGCAGGTACAGG + Intronic
1095295104 12:40518510-40518532 GCAGGCATCACTGCAGCAACAGG + Intronic
1096786526 12:54019929-54019951 GAAGGCATAGCAGCAGCGACCGG + Intronic
1097226080 12:57477545-57477567 GGATGCCTGGGAGCAGCACCTGG - Exonic
1101637956 12:106561837-106561859 ACAGGCATGGCACCAGCATCCGG - Intronic
1101660259 12:106759221-106759243 GCAGGCATGGCAGGAGCCAGGGG + Intronic
1101884932 12:108654560-108654582 TCATACATGGAAACAGCAACAGG + Intronic
1102546598 12:113661702-113661724 GCTTGCATACCACCAGCAACGGG + Intergenic
1102557641 12:113738311-113738333 GCCCAAATGGCAGCAGCAACAGG - Intergenic
1102802248 12:115746176-115746198 GCCTGAATGACAACAGCAACAGG + Intergenic
1106809848 13:33349510-33349532 GCATGCACAGAAGCAGCAAGGGG + Intronic
1107231063 13:38111107-38111129 GCAAGCATGCCAGCAACAAGAGG + Intergenic
1109371412 13:61424919-61424941 GTATGCATGGAAGCACCAAGAGG - Intronic
1111845184 13:93498618-93498640 TCTTACATGGCAGCAGCAAGGGG - Intronic
1111964904 13:94851131-94851153 GCTTCCAAGGCAGCAGCAAGGGG + Intergenic
1112188365 13:97150023-97150045 GCATGGCTGCCTGCAGCAACAGG + Intergenic
1113584790 13:111457898-111457920 GAATGCAGGGGAGCAGCACCAGG + Intergenic
1115149880 14:30272138-30272160 GTTTGCATGGCAGCAGCATTTGG - Intergenic
1118703133 14:68454559-68454581 GCCAGCATGGTAGCAGCCACTGG + Intronic
1119706158 14:76783794-76783816 GGAGGCATGGCAGCAGGAAAAGG + Intergenic
1119840712 14:77790778-77790800 GCAGGAAGGGCAGCAGCAGCTGG + Intergenic
1120739906 14:88096694-88096716 GAAATCAAGGCAGCAGCAACAGG + Intergenic
1121080944 14:91107936-91107958 GCTTCCTTGGCAGCAGCACCTGG - Intronic
1121268629 14:92622537-92622559 GCATGCAAGGCAGAGGCAAGGGG + Intronic
1122829989 14:104391176-104391198 CCACCCATGGCAGCAGCGACTGG - Intergenic
1122967469 14:105138051-105138073 GCAGGCCAGGCAGCAGCAGCTGG - Intergenic
1124382212 15:29176597-29176619 ACATGCAGGGCAGGAGCCACGGG + Intronic
1126929037 15:53626365-53626387 GCCTGATTGGGAGCAGCAACGGG + Intronic
1127525640 15:59790109-59790131 TCTTACATGGCAGCAGCAAGAGG - Intergenic
1129206336 15:74039079-74039101 GCCTTGGTGGCAGCAGCAACAGG + Intronic
1131711641 15:95062234-95062256 GCATGTGTGCCAGCAGCAATAGG + Intergenic
1132110046 15:99096288-99096310 TCATGCATGTCAGCAGGGACTGG + Intergenic
1132120983 15:99175188-99175210 ACATACTTGGCAGCAGCAGCAGG + Intronic
1132214101 15:100050105-100050127 CCATGTGGGGCAGCAGCAACTGG - Intronic
1132394497 15:101462933-101462955 GCTTGCAAGGCAGCAGCCCCAGG + Intronic
1132394693 15:101464158-101464180 GCTTGCAAGGCAGCAGCCCCAGG - Intronic
1132632824 16:928155-928177 GAATGAATCTCAGCAGCAACGGG - Intronic
1137553566 16:49456283-49456305 CCATGCATGGCAGCAGCCCTAGG + Intergenic
1138407359 16:56807218-56807240 GCATTCCTGGCAGAAGCAATAGG - Intronic
1139839094 16:69863737-69863759 CCATGCTTGCCAGCAGCGACGGG - Intronic
1139932397 16:70539140-70539162 ACACACATGGCAGCAGCAACGGG - Exonic
1141774366 16:86112375-86112397 ACACGCATGCCAGCAGCCACTGG + Intergenic
1142376119 16:89707957-89707979 GCATGGATGGCAGGGGCAGCCGG + Intronic
1144018708 17:11221338-11221360 GGAAGCATGGCACCAGCAAGAGG - Intergenic
1144498919 17:15768916-15768938 GTAAGCATTGCATCAGCAACTGG + Intergenic
1145162300 17:20583951-20583973 GTAAGCATTGCATCAGCAACTGG + Intergenic
1147390896 17:40108494-40108516 ACATGTTTTGCAGCAGCAACAGG - Intergenic
1148102017 17:45098061-45098083 GCATGCAGGGAAGCAGCACAGGG - Intronic
1148693494 17:49545954-49545976 GCCTCCATGGCAGCAGCAGCTGG - Intergenic
1149548336 17:57521092-57521114 ACGTGCCTGGCAGCAGCAGCTGG + Intronic
1151481971 17:74374929-74374951 CCATGGATGGCAACAGCAGCTGG + Intergenic
1151658574 17:75507124-75507146 GCATGCCTGGCAGGAGGAAAGGG + Exonic
1152334719 17:79694127-79694149 CCTTGCATGGCAGCAGTCACAGG + Intergenic
1152678292 17:81652933-81652955 GCATGGTTGGCAGTAGCATCTGG + Intronic
1153656106 18:7283797-7283819 ACATGCATGGCAGTAGCACCAGG + Intergenic
1153802607 18:8684522-8684544 TCATGCATGTCAGCATCACCTGG - Intergenic
1157710061 18:49843996-49844018 GCATGCCAAGCAGCAGCACCGGG - Intronic
1160220364 18:76972553-76972575 GTATGAATGGCAGGAGCAACAGG + Intergenic
1160954243 19:1682834-1682856 GCCTGCAGGGAACCAGCAACGGG - Intergenic
1161675535 19:5646254-5646276 CCTTGCATGGCAGAAGCAAATGG - Intronic
1164130197 19:22354882-22354904 GCAGGAATGGCAGCAGCAACTGG - Intergenic
1165064137 19:33219334-33219356 GCATGCACCGCAGCGGCCACGGG - Intronic
1165147564 19:33741147-33741169 GCATGATTGACAGCAGCAGCAGG - Intronic
925050008 2:806065-806087 GGATGGATGGCAGGAGCAGCAGG + Intergenic
925194462 2:1912034-1912056 GCGGGCATGTCAACAGCAACAGG - Exonic
925327291 2:3033269-3033291 GCGGCCATGGCAGCAGCACCCGG + Intergenic
925475076 2:4204298-4204320 TCATGCATGTCAGCAGTATCTGG + Intergenic
926808975 2:16739642-16739664 GCATGCATGGGAACAGTAACTGG - Intergenic
930321518 2:49860250-49860272 GCATGCATAGCTGCAGAATCAGG + Intergenic
932612467 2:73210047-73210069 GCATGGATGGCAGCAGAAGCAGG - Intronic
934736614 2:96692863-96692885 CCTTTCATGGCAGCAGCAAGTGG - Intergenic
934747843 2:96771126-96771148 GCAGGCGTGGCAGCAGACACAGG - Intronic
935618306 2:105108091-105108113 GCAGGCAGGGCAGTAGCATCTGG + Intergenic
935625605 2:105169912-105169934 GCACACATGGCAGCAGCAAAGGG + Intergenic
937851969 2:126643897-126643919 AAATGCATGGCAGCAGGCACAGG - Intergenic
938052707 2:128190006-128190028 GGTGGAATGGCAGCAGCAACTGG + Exonic
939920393 2:148103520-148103542 GCATGTATCGCAACATCAACAGG - Intronic
940104892 2:150088709-150088731 TCCTGCAGGGCAGCATCAACTGG + Intergenic
941259066 2:163273774-163273796 GCATGCATGGAAGCTACAACTGG - Intergenic
942110720 2:172680133-172680155 GCATGCAAGGAAGAAGCACCTGG - Intergenic
943238251 2:185350139-185350161 TAATGCATGGCATCAGCCACTGG - Intergenic
944467576 2:200018554-200018576 ACATGCATGGCAGCAGGCAAAGG + Intergenic
945038109 2:205721601-205721623 GCTTGGATGGCAGCAGGAGCAGG - Intronic
946138741 2:217669755-217669777 AAATGCATGGCACCAGCATCTGG + Intronic
946570786 2:221021898-221021920 ACATTCAAGGCAGAAGCAACTGG + Intergenic
946904243 2:224401079-224401101 GCATGCCTATCAGCAGCACCAGG - Exonic
1172177780 20:32982955-32982977 GCTGGAATGGCAGCAGGAACTGG - Intergenic
1173815520 20:45985155-45985177 GCATGCATGGAAGCAGACAAGGG + Intergenic
1174009909 20:47441332-47441354 GCATTCCTGGCAGCAGGAAGCGG - Intergenic
1174368996 20:50073627-50073649 GCATGCAGGGCAGAGGGAACAGG + Intergenic
1174725961 20:52862324-52862346 GCCAGGATGGCAGCAGCAACGGG + Intergenic
1175836068 20:61995494-61995516 ACCTGCAGGGCAGCATCAACAGG + Intronic
1176140659 20:63543319-63543341 GCATGCAGGGCTGCAGCAGGGGG + Exonic
1177017800 21:15814186-15814208 TCTTACATGGCAGCAGCAAGAGG - Intronic
1177731871 21:25037581-25037603 GAATGCATGGCAGCAGCTCCAGG + Intergenic
1179921058 21:44507844-44507866 GCAGCCATGGCAGGAGAAACAGG - Intronic
1184920949 22:47605580-47605602 GGATGCAGGGCTGCAGCAGCCGG - Intergenic
950887443 3:16374066-16374088 GCAAGCATGACAGCAGCCACAGG + Intronic
952245033 3:31578687-31578709 GCATGCATGGAAGGAGAAAGGGG - Intronic
952722366 3:36546531-36546553 CCATGCTTGGCAGCAGCAGTAGG + Exonic
952983359 3:38756208-38756230 GCTTGCATGGCAGCAGCTGATGG + Intronic
954839042 3:53495199-53495221 GCATCAACGGCAGCAGCAAGCGG + Exonic
954992916 3:54856358-54856380 GCATGCTTGGGAGCAGCAGAAGG + Intronic
956202765 3:66723389-66723411 TCATGCATCCCAGCAGCAAAGGG - Intergenic
961641865 3:128369858-128369880 GCAGGCACAGCAGCAGCACCAGG - Intronic
963054533 3:141174915-141174937 GCAAGGATGGCAGCAGCTGCAGG + Intergenic
963784819 3:149523656-149523678 ACATACATGGCAGCAACAGCTGG - Intronic
965820030 3:172676038-172676060 GCATGCAGGGGAGCAGCAGTTGG - Intronic
967411849 3:189174188-189174210 GCTTGCAGAGCAGCAGCCACAGG + Intronic
969230323 4:5826243-5826265 CCAGACAAGGCAGCAGCAACGGG + Intronic
969260044 4:6027628-6027650 GCATGCAGAGCAGGAGGAACTGG - Intronic
971382976 4:26116743-26116765 GCATGGGTGGCAGCAGCCACAGG - Intergenic
974013185 4:56625654-56625676 TCTTACATGGCAGCAGCAAGAGG - Intergenic
975128767 4:70811536-70811558 GCAGACATGCCAGCAGCAACGGG + Intergenic
976983689 4:91265954-91265976 TCTTACATGGCAGCAGCAAGAGG + Intronic
988865044 5:35324958-35324980 GCATGCTTGTCAGCTGCAGCAGG - Intergenic
988997161 5:36725499-36725521 GCAGGCATGGCATCAGGAAGAGG + Intergenic
990618873 5:57538563-57538585 GCCTGCAGAGCTGCAGCAACTGG - Intergenic
991626437 5:68606123-68606145 GCATGCAAAGCAGCAGGAATAGG + Intergenic
992420344 5:76597543-76597565 TGATACATGGCAGCAGCAAAGGG - Exonic
994089018 5:95792102-95792124 GCAGGCAGGGCAGCAGCAACAGG + Intronic
996497957 5:124183347-124183369 GAAAGCATGACAGCAGGAACTGG + Intergenic
997420067 5:133759694-133759716 GCATGAATAGCTGCAGCACCTGG - Intergenic
998776848 5:145613125-145613147 GCATACATGCCAGCATCTACTGG + Intronic
1000114106 5:158136947-158136969 CCATGAATGGTAACAGCAACTGG - Intergenic
1001437324 5:171710242-171710264 TGCTGCATGGCAGCAGGAACTGG + Intergenic
1002992685 6:2252470-2252492 GAATGCATAGCAGAAGCAGCAGG + Intergenic
1003207529 6:4026936-4026958 GCATTCCTGGCAGGAGAAACAGG + Intronic
1003553870 6:7122884-7122906 ACATGCTTGTCAGCAGAAACTGG - Intronic
1004377545 6:15103835-15103857 TCATGCTTGTCACCAGCAACTGG + Intergenic
1009290724 6:61878182-61878204 CTATGCAGGGCAGCAGGAACTGG - Intronic
1009627012 6:66146994-66147016 GCATGCCCCGCAGCAGCATCTGG + Intergenic
1013750284 6:113397992-113398014 GCATGAATGGTTGCAGAAACTGG - Intergenic
1018088829 6:160328452-160328474 AAATGCATAGCAGGAGCAACTGG + Intergenic
1018717173 6:166542402-166542424 GCATCCATGGCAGGAGCATGTGG + Intronic
1019570994 7:1712082-1712104 AGATGCCTGGCAGCAGCTACGGG + Intronic
1019919583 7:4154939-4154961 GGGAGCATGGCAGGAGCAACGGG + Intronic
1020706150 7:11546254-11546276 GCATGCATGCCATCAACTACAGG - Intronic
1022291606 7:29009936-29009958 GCAAGGATGGCAGCATCAGCAGG - Intronic
1026950653 7:74344258-74344280 GCAGGGTTGGCAGCAGCAAGGGG + Intronic
1027306834 7:76907197-76907219 GCATGCATGGAGGCAGAAAAAGG + Intergenic
1028890342 7:95980205-95980227 GCATACAGTGCAGCAGGAACAGG - Intronic
1035257817 7:157643199-157643221 GCCAGCATGGCAGCAGGGACTGG + Intronic
1036149597 8:6285304-6285326 GCATTCCTGACAGCAGCAGCAGG + Intergenic
1037143059 8:15540517-15540539 GGATGCAGAGCAGCAGCAGCAGG - Exonic
1037362657 8:18090229-18090251 GCATGCATGCCAGCAGCAATGGG - Intergenic
1039672084 8:39612781-39612803 GGAGCTATGGCAGCAGCAACAGG - Intronic
1039672127 8:39613056-39613078 GCATGCATGGCAGCAGCAACAGG - Intronic
1039753444 8:40497950-40497972 GCAGACGTGGCAGCCGCAACAGG - Intergenic
1039823314 8:41152925-41152947 GGATCCAAGGCAGCAGCAATGGG + Intergenic
1041777585 8:61540423-61540445 GCTTACATGGCAGCATGAACAGG - Intronic
1041801005 8:61798941-61798963 GAATGCTTGACAGAAGCAACCGG - Intergenic
1043211626 8:77526725-77526747 TCAGGCATGGCAGCATCAAGGGG + Intergenic
1043337476 8:79194205-79194227 GCATGCATGACATTAGCTACTGG - Intergenic
1044171658 8:89060403-89060425 TCATCTATGGCAGCAGCAAGAGG - Intergenic
1046064385 8:109179442-109179464 GTATGTATGCCAGCAGCAAAAGG + Intergenic
1048645429 8:136414326-136414348 GCATGCAGGCCATAAGCAACTGG - Intergenic
1049573101 8:143378675-143378697 GCCTGCAGGGCAGGAGCCACTGG - Exonic
1050119865 9:2297176-2297198 GCATGAATGGGAGCAGCAACAGG + Intergenic
1062381924 9:136290814-136290836 GCATGCTTGGCAGCCGAGACGGG + Exonic
1185604177 X:1358169-1358191 GCAGGCATAGCTGCAGCCACAGG + Intronic
1190406568 X:50093864-50093886 GGAGGCATGGCAGCAGCAACTGG - Exonic
1191116547 X:56858759-56858781 TCTTACATGGCAGCAGCAAGAGG + Intergenic
1192907798 X:75569893-75569915 GAATCAATGGCAGCAACAACTGG + Intergenic
1193891323 X:87049748-87049770 GCATGGATGCCAGCTGGAACAGG + Intergenic
1193980526 X:88176423-88176445 ACATGCATGGCAGCAGAGGCAGG - Intergenic
1196148334 X:112344470-112344492 TCTTGCATGGCAGGAGCAAAAGG + Intergenic
1196982597 X:121231710-121231732 GCATGCCTGTCAGCTGCAGCAGG + Intergenic
1197277828 X:124500481-124500503 GCATGTGTGGCAGAAGAAACTGG - Intronic
1197345958 X:125326136-125326158 GCTTGCAAGGCAGCAGCACCAGG - Intergenic
1198394223 X:136206647-136206669 ACAACCATGGCAGCAGCAGCTGG + Intronic
1199499896 X:148497900-148497922 GCATGGAGGGCAGTAGCAAGAGG - Intergenic
1199698536 X:150360779-150360801 GCCTGCTTGGCACCAGCACCTGG - Intergenic
1199913064 X:152308320-152308342 GTATGCATGCCAGCAGCAGAAGG - Intronic