ID: 1039678323

View in Genome Browser
Species Human (GRCh38)
Location 8:39698470-39698492
Sequence GGTCTCCAGTGGACACTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 1, 2: 12, 3: 56, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039678323_1039678326 -4 Left 1039678323 8:39698470-39698492 CCAGCTAGTGTCCACTGGAGACC 0: 1
1: 1
2: 12
3: 56
4: 191
Right 1039678326 8:39698489-39698511 GACCCTTTTGGTGAATTGCTTGG No data
1039678323_1039678329 25 Left 1039678323 8:39698470-39698492 CCAGCTAGTGTCCACTGGAGACC 0: 1
1: 1
2: 12
3: 56
4: 191
Right 1039678329 8:39698518-39698540 AGAAAATACCCCAACACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039678323 Original CRISPR GGTCTCCAGTGGACACTAGC TGG (reversed) Intronic
900699240 1:4033841-4033863 GATCTCCAGCAGACACCAGCTGG + Intergenic
901828836 1:11879915-11879937 GGGGTGCAGTGGACACTAGAAGG - Intergenic
904186810 1:28711854-28711876 ACTCTCCAGTGGACACTGACTGG + Intronic
905159019 1:36014996-36015018 GTTCTGCAGTGGACACCAGCTGG + Intronic
905235843 1:36547586-36547608 ATTCTCCAGTGGACCCCAGCTGG + Intergenic
905582537 1:39093185-39093207 GTTCTGCAGTGGACACCAGCGGG + Intronic
908849826 1:68364556-68364578 GTTCTGCAGTGGACACCAGTGGG + Intergenic
910006421 1:82402830-82402852 AGTCTCAAGGGGACACTAACTGG - Intergenic
910656625 1:89626331-89626353 GTTCTCCAATGGACACTGACTGG + Intergenic
912667790 1:111598740-111598762 GTTCTGCAGTGGATACCAGCTGG + Intronic
912697264 1:111850655-111850677 GGTCCCCAGTGGCCAGTGGCCGG - Intronic
914258193 1:145977417-145977439 GGTCTCCAGTGAATACTGACTGG - Intronic
916027731 1:160849097-160849119 ATTCTGCAGTGGACACCAGCTGG - Intronic
916027883 1:160850775-160850797 GCTCTTCAGTGGACACCAACTGG + Intronic
916484318 1:165244522-165244544 ATTCTCCAGTGGACACCAGCTGG - Intronic
916531396 1:165660102-165660124 GTTCTGCAGTGGACACCAGCTGG + Intronic
917522371 1:175758938-175758960 GGTCTACAGTAGACACTGGTGGG + Intergenic
917543443 1:175937505-175937527 ATTCTGCAGTGGACACTGGCTGG - Intergenic
919493125 1:198229588-198229610 GTTCTGCAGTGGACACCAGCTGG - Intronic
919650412 1:200143601-200143623 GGAGTCCAGTGAACAGTAGCTGG - Intronic
919873382 1:201841993-201842015 GTTCTGTAGTGGACACCAGCTGG + Intronic
920107332 1:203563243-203563265 TATCTCCAGTGGGCACCAGCAGG + Intergenic
921436879 1:215134190-215134212 GTTCTCCACTGGACACCAGCTGG + Intronic
921584891 1:216935158-216935180 GTTCTCCAGTGGTCACCAACTGG + Intronic
922819584 1:228474863-228474885 ATTCCCCAGTGGACACCAGCTGG + Intergenic
922820315 1:228480233-228480255 ATTCCCCAGTGGACACCAGCTGG + Intergenic
922863781 1:228841412-228841434 ATTTTCCAGTAGACACTAGCTGG - Intergenic
1062821757 10:540209-540231 GGTCTCCCGCAGACACTAGACGG + Intronic
1063276278 10:4572105-4572127 TTTCTGCAGTGGACACCAGCTGG + Intergenic
1063453699 10:6168553-6168575 GGTTTCCAGTGGCCACCAGCAGG - Intronic
1063618683 10:7624939-7624961 GGTCTCCAATGGACACGTGATGG - Intronic
1063835134 10:10003837-10003859 GTTCTGCAGTGGACACCAGCTGG + Intergenic
1063869910 10:10405781-10405803 GCTCTGCAGTGGGCACCAGCTGG - Intergenic
1064979300 10:21149858-21149880 GTTCTGCAGTGGACATCAGCTGG - Intronic
1065209234 10:23387109-23387131 ATTCTCCAGTGGACACCAACTGG + Intergenic
1071859588 10:89658642-89658664 ATTCTCCAGTGGACACCAACTGG + Intergenic
1072272959 10:93795043-93795065 GTTTTCCAGTGGACTATAGCAGG + Intronic
1074153574 10:110779696-110779718 GTTCTGCAGTGGACACCAGCTGG - Intronic
1076403722 10:130199178-130199200 GGTCTCCAGGTGACCCTGGCCGG + Intergenic
1078257559 11:9673039-9673061 GTTCTGCAGTGGACACCAGCTGG + Intronic
1078541013 11:12213115-12213137 GATCTCTAGTGGACAGGAGCGGG - Intronic
1078880232 11:15440665-15440687 GTTCTCCAGCAGACACCAGCTGG - Intergenic
1080302958 11:30804717-30804739 GTTCTCCAGTGGACACTAATGGG - Intergenic
1080350702 11:31382737-31382759 GTTCTCCAGTGGACACCAATTGG + Intronic
1081467198 11:43332252-43332274 GTTCTGCAGTGGATACTAGCTGG + Intronic
1083918344 11:65765058-65765080 ATTCTCTAGTGGACACTAACAGG - Intergenic
1084916040 11:72429769-72429791 AGTCTCCAGTGACCACTGGCAGG - Intronic
1085487573 11:76880404-76880426 GTTTTGCAGTGGACACTAGCTGG + Intronic
1085515097 11:77107090-77107112 GGTCTCCGGTGGAGAGCAGCAGG + Intronic
1085693753 11:78686643-78686665 ACTCTGCAGTGGACACCAGCTGG - Intronic
1087487542 11:98775251-98775273 GGACTCCAGTGGATAGCAGCAGG + Intergenic
1089763385 11:120745194-120745216 GATGTCCAGTGGACTCTGGCCGG - Intronic
1090058307 11:123442094-123442116 GTTCTCCAGTGGACACAAACTGG + Intergenic
1090325098 11:125879218-125879240 GCTCTGCAGTGGACATCAGCTGG + Intergenic
1094568088 12:31617831-31617853 ATTCTGCAATGGACACTAGCTGG - Intergenic
1095389250 12:41686558-41686580 ATTCTGCAGTGGACACCAGCTGG + Intergenic
1095519134 12:43041225-43041247 GTTCTGCAGTGAACACCAGCTGG + Intergenic
1095749340 12:45694210-45694232 GTTCCGCAGTGGACACCAGCTGG + Intergenic
1097308862 12:58097117-58097139 GTTTTCCAGTGGACACCAGCTGG + Intergenic
1097463317 12:59890743-59890765 ATTCTGCAGTGGACACCAGCTGG - Intergenic
1097541297 12:60946810-60946832 GTTCTCAAGTGGACATCAGCTGG - Intergenic
1101297953 12:103445227-103445249 GTTCTGCAGTGGACACCAGCTGG - Intronic
1101558785 12:105835985-105836007 GGTCTCCAGTAAACATTTGCTGG + Intergenic
1102078624 12:110080171-110080193 AGTCTCCAGGGGACCCTAGTGGG + Intergenic
1102569527 12:113819032-113819054 GGCCAGCAGTGGGCACTAGCGGG - Intronic
1102588518 12:113940206-113940228 GGTCCCCAGCTGACACCAGCAGG + Intronic
1105011548 12:132760349-132760371 GTTCTGCAGTGGACACAGGCTGG + Intronic
1112120025 13:96399699-96399721 GGTCTCCCATGTACACTGGCTGG + Intronic
1112431118 13:99350898-99350920 GTGCTCCAGTGGACACCAGCAGG - Intronic
1113018934 13:105860164-105860186 GGTCTCCAGTGGGCACCAGGAGG - Intergenic
1113927111 13:113947705-113947727 GGCCTGTAGTGGACACAAGCAGG + Intergenic
1118048934 14:62004996-62005018 GGTCTCCAGTGAACACTGTGTGG + Intronic
1119608731 14:76043744-76043766 GTTCTGCAGTGGACACTAGCTGG + Intronic
1121467165 14:94123377-94123399 TGTCTCCAGTGGTCCCCAGCGGG - Intergenic
1121624408 14:95373833-95373855 GTTCTCCAGCGGACACCAGCGGG + Intergenic
1124183719 15:27502508-27502530 GTTCTGCAGGGGACACCAGCTGG + Intronic
1124346795 15:28928431-28928453 GGACTCCAGTGTACAACAGCAGG - Intronic
1124405760 15:29390088-29390110 GGTCTCCAGTGGGCCAGAGCTGG - Intronic
1124434282 15:29634558-29634580 GTTCTGCAGTGGACACCAGCTGG + Intergenic
1125599221 15:40906504-40906526 AGTCTGCAGTGGGCACTAGGGGG + Intergenic
1126202779 15:46006560-46006582 GTTCTCCAGTGGACACCAGCTGG + Intergenic
1127055987 15:55132043-55132065 GTTCTTCAGTGGATACCAGCTGG - Intergenic
1128633294 15:69286137-69286159 GTTCTGCAGTGGACACCAGCTGG - Intergenic
1129197295 15:73976448-73976470 GTTCTGCAGTGGCCACCAGCTGG - Intergenic
1129778735 15:78254841-78254863 GTTCTGCAGTGGACATCAGCTGG - Intergenic
1130303203 15:82695893-82695915 GTTCTCCAGCAGACACTAACTGG - Intronic
1131365033 15:91831622-91831644 CCTCTCCAGTGGACACCAGGTGG - Intergenic
1131983928 15:98022587-98022609 GTTCTGCAGCAGACACTAGCTGG + Intergenic
1132138354 15:99367004-99367026 GTTCTCCAGTAGACACTAGCTGG + Intronic
1132166224 15:99594028-99594050 GTTCTCCAGTGGACACCAGCTGG + Intronic
1133232368 16:4372703-4372725 GGTCCCCTGTGGTCACTGGCAGG + Intronic
1134098353 16:11434530-11434552 GTTCTCTGGTGGACACTAACTGG - Intronic
1134221616 16:12359198-12359220 GTTCTGCAGCGGACACCAGCTGG - Intronic
1134297428 16:12959467-12959489 GGACTACAGTGGACAGTAGAGGG - Intronic
1136381801 16:29899444-29899466 GGTCTCCACTGGGCTCTAGCGGG + Exonic
1138272863 16:55708623-55708645 GGTCTCAAGTGGACACTGGGGGG - Intergenic
1140530513 16:75661921-75661943 GTTCTGCAGTGCACACCAGCTGG + Intronic
1141300942 16:82814906-82814928 ATTCTTCAGTGGACACCAGCGGG - Intronic
1141627033 16:85266769-85266791 GGGCTCTAGTGGACTCTTGCAGG + Intergenic
1143378756 17:6482720-6482742 GTTCTGCTGTGGACACCAGCTGG - Intronic
1143577510 17:7803087-7803109 GTTCTCCAGGGGACACTGGCTGG + Intronic
1146286522 17:31577787-31577809 TGGCTCCAGTGGGCACTGGCCGG + Intergenic
1148997698 17:51725572-51725594 GGTACCCAGTGGCCACTTGCTGG + Intronic
1149387846 17:56159611-56159633 TGTCTCCAATGGACACTGTCAGG - Intronic
1151777315 17:76214232-76214254 GTTCTGCAGAGGACACCAGCTGG - Intronic
1152051262 17:77980454-77980476 GTTCTGCAGTGGACACCAGCTGG + Intergenic
1153257188 18:3183484-3183506 GGTGTCCAGTGGAAACTGGTTGG + Intronic
1156989316 18:43388055-43388077 GTTCTCCAGTGGATACCAGCTGG - Intergenic
1157807315 18:50667828-50667850 GTTCTTCAGTGGACACCAGCTGG + Intronic
1159482523 18:69008561-69008583 TGTCTTCAGTGGATACTAGGAGG + Intronic
1160422287 18:78755345-78755367 GGTCTCCAGTGGTCATTACTTGG + Intergenic
1160422352 18:78755659-78755681 GGTGTCCAGTGGTCATTACCTGG + Intergenic
1161884158 19:6980670-6980692 GTTCTCCAGTGGACCCCAGCTGG - Intergenic
1162106743 19:8374289-8374311 GGTCCCCTGGGGACACAAGCAGG + Exonic
1162235142 19:9303182-9303204 ATTCCCCAGTGGACACCAGCTGG + Intronic
1163038149 19:14583481-14583503 GGTCTCCAGTGGGCATTGGTTGG + Intronic
1163038838 19:14587738-14587760 GGTCTCCAGTGGGCATTGGTTGG + Intronic
1163541099 19:17911080-17911102 ATTCTCCAGTGGACACCAGCTGG + Intergenic
1166264260 19:41668035-41668057 GTACTGCAGTGGACACTGGCTGG - Intronic
1166940097 19:46357456-46357478 ATTCTGCAGTGGACACCAGCTGG + Intronic
1168153929 19:54462991-54463013 GGTGCCGAGTGGACACTGGCGGG - Exonic
925708955 2:6719011-6719033 GGTTTGCAGTAGACACTTGCAGG - Intergenic
927166766 2:20330912-20330934 ATTCTCCAGTGGACACCAGCTGG - Intronic
930090045 2:47525456-47525478 GGACTCCAGGGGACACTGCCGGG - Intronic
931283219 2:60811588-60811610 GTTCTGCAGTGGACACCAGCTGG + Intergenic
931958080 2:67450821-67450843 GTTCTGCAGTGGACACCAGCTGG + Intergenic
935985218 2:108666060-108666082 GTTCTGCAGTGGACACCAGCTGG + Intronic
936117521 2:109713912-109713934 ATTCTCCAGGGGACACCAGCTGG + Intergenic
936137652 2:109909706-109909728 GTTCTGCAGTGGACACCAGCTGG + Intergenic
936207045 2:110461779-110461801 GTTCTGCAGTGGACACCAGCTGG - Intronic
936602387 2:113910632-113910654 ATTCTGCAGTGGACACTAGCTGG - Intronic
938147477 2:128848821-128848843 GGTCTTCAGTGGACACAAGCTGG - Intergenic
938884203 2:135626151-135626173 GTTCTACAGTGGACAACAGCTGG - Intronic
940190810 2:151038127-151038149 GTTCTCCACTGGACACCAACTGG - Intronic
940549905 2:155140493-155140515 ATTCTGCAGTGGACACCAGCTGG - Intergenic
941299838 2:163787639-163787661 GTTCTGCAGTGGACACCAGCTGG + Intergenic
941310668 2:163926657-163926679 GTTCTGCAGTGGACACCAGCTGG - Intergenic
941748262 2:169109932-169109954 GCTCTCAATTGGACACTAGGGGG + Intergenic
946937098 2:224733740-224733762 GTTCTGTAGTGGACACCAGCTGG + Intergenic
947073952 2:226320746-226320768 GGTCACCAGTCGCCGCTAGCTGG + Intergenic
948858379 2:240741137-240741159 GGTCTGCAGTGAACACCCGCTGG + Intronic
949025308 2:241765051-241765073 TGTCTGCAGTGGGCACTGGCTGG + Intronic
1169319332 20:4618435-4618457 ATTCTCCACTGGACACCAGCTGG + Intergenic
1169512843 20:6283888-6283910 GTTTTGCAGTGGACACCAGCTGG + Intergenic
1172365381 20:34345193-34345215 GTTCTGCAGTGGACACCAGCTGG + Intergenic
1173175655 20:40762966-40762988 CAGCTCCAGTGGACACAAGCAGG + Intergenic
1173993113 20:47318146-47318168 GGTCTCCAGTCTACACAGGCCGG - Intronic
1175385390 20:58591680-58591702 TGACTCCTGTGGACACTAGCAGG - Intergenic
1177029729 21:15967627-15967649 AATCTCCAGCAGACACTAGCTGG - Intergenic
1177063396 21:16400231-16400253 ATTCTGCAGTGGACACCAGCTGG + Intergenic
1177175798 21:17699718-17699740 GTTCTCCAGTGGACCGCAGCTGG + Intergenic
1178032470 21:28543487-28543509 ATTCTCTAGTGGACACCAGCTGG - Intergenic
1178342856 21:31800938-31800960 AGTCTGCAGCGGACACCAGCTGG + Intergenic
1178676238 21:34634101-34634123 GTTCTGCAGCGGACACCAGCTGG + Intergenic
1181692154 22:24569540-24569562 GTTCTGCAGTAGACACCAGCTGG + Intronic
1183832908 22:40428321-40428343 GTTCTCCAGTGGACACCAGCTGG - Intronic
1183872053 22:40747436-40747458 AGTCTCCCGTGGACAACAGCTGG + Intergenic
1184367545 22:44062173-44062195 GTTCTCCAGCAGACACCAGCTGG + Intronic
1184960533 22:47925272-47925294 GGTATTCAGAGGACACTTGCTGG + Intergenic
1185060211 22:48602745-48602767 GGTGTTCACTGGACACCAGCAGG - Intronic
949897564 3:8779557-8779579 GTGCTCCAGTAGACATTAGCTGG + Intronic
951499469 3:23367866-23367888 ATTCTGCAGTGGACACCAGCTGG - Intronic
951883235 3:27499724-27499746 ATTCTCTAGTGGACAATAGCTGG - Intergenic
953528093 3:43712224-43712246 GCTCTCCAGTGCTCACCAGCAGG - Intronic
954074810 3:48170200-48170222 GTTCTGCAGTGGAAAATAGCTGG + Intronic
956992862 3:74788730-74788752 GTTCTGCAGTGGACACCAGCTGG + Intergenic
957984104 3:87550585-87550607 TTTCTGCAGTGGACACCAGCTGG + Intergenic
960021141 3:112954999-112955021 ATTCTTCAGTGGACACCAGCTGG - Intronic
960971978 3:123146295-123146317 GGTCTCCAGGGGCCGCCAGCTGG - Intronic
961051530 3:123751063-123751085 GGTTTTCAGGGGACACTAGATGG - Intronic
962100689 3:132339356-132339378 GTTCTGCAGTAGACACCAGCTGG + Intronic
963788239 3:149556951-149556973 GGTCTTCTGTGAACACTGGCTGG + Intronic
964239999 3:154581174-154581196 ATTCTCCAGTGGACACCAACTGG - Intergenic
964748404 3:160032872-160032894 GTTCTCCAGTGGACACTAGCTGG + Intergenic
964914021 3:161817671-161817693 GTTCTCCAGTGGACACGAGCTGG + Intergenic
966726601 3:183114500-183114522 GTTCTGCAGTGGACACCAGATGG - Intronic
967776384 3:193390714-193390736 GTTCTCCAGTGGACACCAGCTGG + Intergenic
968846521 4:3045367-3045389 GTTCTGCAGCGGACACCAGCTGG - Intergenic
968980136 4:3843173-3843195 ATTCTGCAGTGGACACCAGCCGG - Intergenic
969595589 4:8147809-8147831 GGTCACCAGTGACCACAAGCTGG - Intronic
970264574 4:14267230-14267252 GGTGTCCAGTGGAGACTGGCCGG + Intergenic
975285334 4:72611129-72611151 GCTCTCCAGTGGCCACAACCAGG - Intergenic
976260877 4:83143729-83143751 GTTATGCAGTGGACACAAGCTGG - Intergenic
977235685 4:94505128-94505150 TTTCTCCAGTGGACACCAGCCGG + Intronic
980922816 4:139103734-139103756 GTTCTGTAGTGGACACCAGCTGG - Intronic
982865564 4:160505927-160505949 GTTCTGCAGTGGACACCTGCTGG - Intergenic
984183323 4:176512193-176512215 ATTCTCCAGCGGACACTAACCGG + Intergenic
990586649 5:57218159-57218181 GTTCTCCAGCAGACACTACCTGG + Intronic
992433264 5:76730582-76730604 ATTCTCCAGTGGACACCAGCTGG + Intronic
992788449 5:80192122-80192144 GGCCTCCAGTGTGTACTAGCTGG + Intronic
995586534 5:113654333-113654355 GTTCTGCAGTGGACACCACCTGG - Intergenic
996568837 5:124910427-124910449 GTTCTCCACTGGACACCAACTGG - Intergenic
996726803 5:126679699-126679721 GCTCTCTAGTGGACATTAGCTGG - Intergenic
1000273006 5:159704781-159704803 CTTCTCCAGTGGAAACTAACTGG + Intergenic
1000813573 5:165891832-165891854 GTTTTGCAGTGGACACCAGCTGG - Intergenic
1000984208 5:167849494-167849516 GTTCTCCAGTGGACACCAGCTGG + Intronic
1002041847 5:176520507-176520529 GGGCTCCAGTGCACACCTGCAGG - Intergenic
1002533830 5:179865235-179865257 GGGCTCCAGTGGAGCCTACCTGG + Exonic
1003018351 6:2487371-2487393 ATTCTCCAGTGGACACCAGCTGG + Intergenic
1003192861 6:3889568-3889590 GTTCTTCAGGGGACACCAGCTGG - Intergenic
1003901379 6:10658947-10658969 GGTCTCCTGTGGTCACAAGATGG + Intergenic
1004931056 6:20463738-20463760 ATTCTGCAGTGGACACCAGCTGG + Intronic
1004931634 6:20468132-20468154 ATTCTGCAGCGGACACTAGCTGG + Intronic
1005286576 6:24334143-24334165 TGTCTTCACTGGAAACTAGCTGG + Intronic
1005310483 6:24554162-24554184 GCTTTGCAGTGGACACCAGCTGG - Intronic
1005504513 6:26458203-26458225 GGTCTGCTGTGGACACGAGACGG + Intronic
1006071946 6:31504958-31504980 CCACCCCAGTGGACACTAGCTGG + Intronic
1008646463 6:53519432-53519454 GGTATCCAGTGGACTCTGGTGGG - Intronic
1009703225 6:67210836-67210858 CGTCTCCAGGGGACAAGAGCAGG - Intergenic
1011291364 6:85780680-85780702 GTTCTCCAGTGGACACCAGCTGG + Intergenic
1011821726 6:91260904-91260926 ATTCTACAGTGGACACCAGCTGG - Intergenic
1013276447 6:108589571-108589593 GGTTTCCAGTGCAGACTTGCAGG + Intronic
1016825632 6:148386105-148386127 GTTCTGCAGTGGACACTAGCTGG - Intronic
1016951737 6:149587275-149587297 ATTCTCCAGTGGACACCAGCTGG + Intronic
1018011971 6:159678841-159678863 GTTGTCCAGTGGACACCAGCTGG - Exonic
1018234697 6:161712900-161712922 GTTCTCCAGTGGACACCAACTGG + Intronic
1018626912 6:165788861-165788883 GGTATTCAGTGGAGACAAGCAGG + Intronic
1019384757 7:748316-748338 GGCCACCACTGCACACTAGCCGG - Intronic
1019658007 7:2207956-2207978 GTTCTCCAGGGGTCACCAGCTGG - Intronic
1019682590 7:2359817-2359839 GTTCTCCAGGGGCCACCAGCTGG - Intronic
1021158950 7:17247596-17247618 GTTCTGTAGTGGACACCAGCTGG - Intergenic
1021924768 7:25523680-25523702 AGTCTACAGTGAACACTAGGTGG - Intergenic
1023299943 7:38759272-38759294 GTTCTGCAGTGGACACCAGCTGG - Intronic
1024189652 7:46993174-46993196 GGTTTCCACTGGGCACTACCTGG - Intergenic
1028142083 7:87285328-87285350 TGTCTCCATTGGACCCTAGAAGG + Intergenic
1028422794 7:90652040-90652062 GCTCACCAGTGGGCACTTGCAGG + Intronic
1031045715 7:116885438-116885460 GTTCTACAGCGGACACCAGCTGG + Intronic
1031304019 7:120101541-120101563 ATTCTGCAGTGGACACCAGCAGG + Intergenic
1033434170 7:141317536-141317558 GGTGTCCAGGAGACACTAGGAGG + Intronic
1035788248 8:2279451-2279473 ATTCTCCAGAGGACACCAGCTGG - Intergenic
1035804558 8:2442254-2442276 ATTCTCCAGAGGACACCAGCTGG + Intergenic
1036697519 8:10987559-10987581 GCTGTGCAGTGGACACTAACTGG + Intronic
1038896289 8:31786423-31786445 GTTCTGCAGCTGACACTAGCTGG + Intronic
1039118509 8:34119160-34119182 CTTCTCCAGTGGACACTTGAAGG + Intergenic
1039229765 8:35430653-35430675 GTTCTACAGAGGACACCAGCTGG - Intronic
1039299240 8:36191571-36191593 GTTCTCCAGTGAACACCAGCTGG - Intergenic
1039678323 8:39698470-39698492 GGTCTCCAGTGGACACTAGCTGG - Intronic
1042321327 8:67478576-67478598 ACTCTGCAGTGGACACCAGCTGG - Intronic
1042803839 8:72750580-72750602 GGTCTCCAGAGGAGACTTTCAGG + Intronic
1044553315 8:93535879-93535901 GTTCTGCAGTGGACACCAGCTGG + Intergenic
1045311720 8:101009024-101009046 GTTCTGCAGTGGACACCAGCTGG + Intergenic
1045492635 8:102681861-102681883 GGTCTCTGGTGGCCAGTAGCTGG - Intergenic
1047572177 8:126110913-126110935 GTTCACCAGAGGACACAAGCTGG - Intergenic
1048223639 8:132565221-132565243 GGTCTCCCCTGGACATTTGCAGG + Intergenic
1049002172 8:139833080-139833102 AGTCTCCAGCGGACATCAGCAGG + Intronic
1049541938 8:143212602-143212624 GCTCTCCACCGGACACCAGCAGG + Intergenic
1049729871 8:144171059-144171081 GTTGTGCAGTGGACACCAGCTGG + Intronic
1051339960 9:16102083-16102105 GGTCTCCAGCGTACACTTACAGG + Intergenic
1051484498 9:17593387-17593409 ATTCTCCACTGGACACCAGCTGG - Intronic
1052817035 9:33109790-33109812 GTTTTCTAGTGGACACTAGCTGG - Intronic
1052944127 9:34153744-34153766 GTTCTCCAGTGGACACCAACTGG - Intergenic
1054918913 9:70522443-70522465 GTTCTGCAGTGGCCACCAGCTGG + Intergenic
1056663038 9:88558726-88558748 GTTCTCCAGTGGACACCAGCTGG - Intronic
1057666648 9:97051088-97051110 GTTTTGCAGTGGACACCAGCAGG - Intergenic
1061732957 9:132630820-132630842 GGTGTCCAGAGGACACTGGAGGG + Intronic
1188433547 X:30134762-30134784 ATTCTGCAGTGGACACCAGCCGG + Intergenic
1189312447 X:40029230-40029252 GCCCTGCAGTGGACACCAGCTGG - Intergenic
1189464123 X:41265154-41265176 GTTCTGCAGTGGACACCAACTGG - Intergenic
1189983323 X:46531520-46531542 ATTCTCCAGTGGACACCAGCTGG - Intronic
1191101862 X:56738380-56738402 ATTCTGCAGTGGACACCAGCTGG + Intergenic
1195087318 X:101424577-101424599 GTTTTGCAGTGGACACCAGCTGG - Intronic