ID: 1039680725

View in Genome Browser
Species Human (GRCh38)
Location 8:39732652-39732674
Sequence CTTGATATCCAGAATGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039680723_1039680725 10 Left 1039680723 8:39732619-39732641 CCTTAAGCAACTGTGTATATTGT No data
Right 1039680725 8:39732652-39732674 CTTGATATCCAGAATGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039680725 Original CRISPR CTTGATATCCAGAATGTAGA AGG Intergenic
No off target data available for this crispr