ID: 1039685922

View in Genome Browser
Species Human (GRCh38)
Location 8:39801762-39801784
Sequence TGTCAGGATTAGACCTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039685919_1039685922 -7 Left 1039685919 8:39801746-39801768 CCCACTGAGGAGGATGTGTCAGG 0: 1
1: 0
2: 3
3: 60
4: 1419
Right 1039685922 8:39801762-39801784 TGTCAGGATTAGACCTAGAGAGG No data
1039685917_1039685922 -3 Left 1039685917 8:39801742-39801764 CCCACCCACTGAGGAGGATGTGT 0: 1
1: 0
2: 0
3: 20
4: 399
Right 1039685922 8:39801762-39801784 TGTCAGGATTAGACCTAGAGAGG No data
1039685921_1039685922 -8 Left 1039685921 8:39801747-39801769 CCACTGAGGAGGATGTGTCAGGA 0: 1
1: 0
2: 2
3: 73
4: 1842
Right 1039685922 8:39801762-39801784 TGTCAGGATTAGACCTAGAGAGG No data
1039685916_1039685922 -2 Left 1039685916 8:39801741-39801763 CCCCACCCACTGAGGAGGATGTG 0: 1
1: 0
2: 0
3: 30
4: 401
Right 1039685922 8:39801762-39801784 TGTCAGGATTAGACCTAGAGAGG No data
1039685918_1039685922 -4 Left 1039685918 8:39801743-39801765 CCACCCACTGAGGAGGATGTGTC 0: 1
1: 0
2: 2
3: 21
4: 298
Right 1039685922 8:39801762-39801784 TGTCAGGATTAGACCTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039685922 Original CRISPR TGTCAGGATTAGACCTAGAG AGG Intronic
No off target data available for this crispr