ID: 1039687467

View in Genome Browser
Species Human (GRCh38)
Location 8:39820436-39820458
Sequence TGGGATCCTGAAAATTGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039687458_1039687467 24 Left 1039687458 8:39820389-39820411 CCTCCCATGGTACTGCCGTCAAA 0: 1
1: 0
2: 0
3: 6
4: 45
Right 1039687467 8:39820436-39820458 TGGGATCCTGAAAATTGGAATGG No data
1039687459_1039687467 21 Left 1039687459 8:39820392-39820414 CCCATGGTACTGCCGTCAAAGAG 0: 1
1: 0
2: 1
3: 3
4: 47
Right 1039687467 8:39820436-39820458 TGGGATCCTGAAAATTGGAATGG No data
1039687457_1039687467 29 Left 1039687457 8:39820384-39820406 CCTAACCTCCCATGGTACTGCCG 0: 1
1: 0
2: 1
3: 3
4: 52
Right 1039687467 8:39820436-39820458 TGGGATCCTGAAAATTGGAATGG No data
1039687461_1039687467 9 Left 1039687461 8:39820404-39820426 CCGTCAAAGAGAAAGCATTGAGT 0: 1
1: 0
2: 0
3: 20
4: 216
Right 1039687467 8:39820436-39820458 TGGGATCCTGAAAATTGGAATGG No data
1039687460_1039687467 20 Left 1039687460 8:39820393-39820415 CCATGGTACTGCCGTCAAAGAGA 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1039687467 8:39820436-39820458 TGGGATCCTGAAAATTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039687467 Original CRISPR TGGGATCCTGAAAATTGGAA TGG Intronic
No off target data available for this crispr