ID: 1039689616

View in Genome Browser
Species Human (GRCh38)
Location 8:39850094-39850116
Sequence TCACCTTTCTAGTTAATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039689616_1039689620 16 Left 1039689616 8:39850094-39850116 CCCTGAATTAACTAGAAAGGTGA No data
Right 1039689620 8:39850133-39850155 TCCAACATCTAAATTTATCAAGG No data
1039689616_1039689623 24 Left 1039689616 8:39850094-39850116 CCCTGAATTAACTAGAAAGGTGA No data
Right 1039689623 8:39850141-39850163 CTAAATTTATCAAGGGCTCCTGG No data
1039689616_1039689618 -8 Left 1039689616 8:39850094-39850116 CCCTGAATTAACTAGAAAGGTGA No data
Right 1039689618 8:39850109-39850131 AAAGGTGATAAGTTCATGATTGG No data
1039689616_1039689624 27 Left 1039689616 8:39850094-39850116 CCCTGAATTAACTAGAAAGGTGA No data
Right 1039689624 8:39850144-39850166 AATTTATCAAGGGCTCCTGGTGG No data
1039689616_1039689625 28 Left 1039689616 8:39850094-39850116 CCCTGAATTAACTAGAAAGGTGA No data
Right 1039689625 8:39850145-39850167 ATTTATCAAGGGCTCCTGGTGGG No data
1039689616_1039689622 17 Left 1039689616 8:39850094-39850116 CCCTGAATTAACTAGAAAGGTGA No data
Right 1039689622 8:39850134-39850156 CCAACATCTAAATTTATCAAGGG No data
1039689616_1039689619 -7 Left 1039689616 8:39850094-39850116 CCCTGAATTAACTAGAAAGGTGA No data
Right 1039689619 8:39850110-39850132 AAGGTGATAAGTTCATGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039689616 Original CRISPR TCACCTTTCTAGTTAATTCA GGG (reversed) Intergenic