ID: 1039690655

View in Genome Browser
Species Human (GRCh38)
Location 8:39861430-39861452
Sequence AGGGCCTTCCGGCAGTAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039690655_1039690659 2 Left 1039690655 8:39861430-39861452 CCTAGTTACTGCCGGAAGGCCCT No data
Right 1039690659 8:39861455-39861477 TTCCAGATACTTTTTCACTTTGG No data
1039690655_1039690662 10 Left 1039690655 8:39861430-39861452 CCTAGTTACTGCCGGAAGGCCCT No data
Right 1039690662 8:39861463-39861485 ACTTTTTCACTTTGGGAGTCAGG No data
1039690655_1039690663 11 Left 1039690655 8:39861430-39861452 CCTAGTTACTGCCGGAAGGCCCT No data
Right 1039690663 8:39861464-39861486 CTTTTTCACTTTGGGAGTCAGGG No data
1039690655_1039690660 3 Left 1039690655 8:39861430-39861452 CCTAGTTACTGCCGGAAGGCCCT No data
Right 1039690660 8:39861456-39861478 TCCAGATACTTTTTCACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039690655 Original CRISPR AGGGCCTTCCGGCAGTAACT AGG (reversed) Intergenic
No off target data available for this crispr