ID: 1039690659

View in Genome Browser
Species Human (GRCh38)
Location 8:39861455-39861477
Sequence TTCCAGATACTTTTTCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039690655_1039690659 2 Left 1039690655 8:39861430-39861452 CCTAGTTACTGCCGGAAGGCCCT No data
Right 1039690659 8:39861455-39861477 TTCCAGATACTTTTTCACTTTGG No data
1039690649_1039690659 29 Left 1039690649 8:39861403-39861425 CCCATCACCACAGTTCAACCTGC No data
Right 1039690659 8:39861455-39861477 TTCCAGATACTTTTTCACTTTGG No data
1039690652_1039690659 11 Left 1039690652 8:39861421-39861443 CCTGCATGACCTAGTTACTGCCG No data
Right 1039690659 8:39861455-39861477 TTCCAGATACTTTTTCACTTTGG No data
1039690651_1039690659 22 Left 1039690651 8:39861410-39861432 CCACAGTTCAACCTGCATGACCT No data
Right 1039690659 8:39861455-39861477 TTCCAGATACTTTTTCACTTTGG No data
1039690656_1039690659 -9 Left 1039690656 8:39861441-39861463 CCGGAAGGCCCTGCTTCCAGATA No data
Right 1039690659 8:39861455-39861477 TTCCAGATACTTTTTCACTTTGG No data
1039690650_1039690659 28 Left 1039690650 8:39861404-39861426 CCATCACCACAGTTCAACCTGCA No data
Right 1039690659 8:39861455-39861477 TTCCAGATACTTTTTCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039690659 Original CRISPR TTCCAGATACTTTTTCACTT TGG Intergenic