ID: 1039690662

View in Genome Browser
Species Human (GRCh38)
Location 8:39861463-39861485
Sequence ACTTTTTCACTTTGGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039690651_1039690662 30 Left 1039690651 8:39861410-39861432 CCACAGTTCAACCTGCATGACCT No data
Right 1039690662 8:39861463-39861485 ACTTTTTCACTTTGGGAGTCAGG No data
1039690656_1039690662 -1 Left 1039690656 8:39861441-39861463 CCGGAAGGCCCTGCTTCCAGATA No data
Right 1039690662 8:39861463-39861485 ACTTTTTCACTTTGGGAGTCAGG No data
1039690655_1039690662 10 Left 1039690655 8:39861430-39861452 CCTAGTTACTGCCGGAAGGCCCT No data
Right 1039690662 8:39861463-39861485 ACTTTTTCACTTTGGGAGTCAGG No data
1039690652_1039690662 19 Left 1039690652 8:39861421-39861443 CCTGCATGACCTAGTTACTGCCG No data
Right 1039690662 8:39861463-39861485 ACTTTTTCACTTTGGGAGTCAGG No data
1039690657_1039690662 -9 Left 1039690657 8:39861449-39861471 CCCTGCTTCCAGATACTTTTTCA No data
Right 1039690662 8:39861463-39861485 ACTTTTTCACTTTGGGAGTCAGG No data
1039690658_1039690662 -10 Left 1039690658 8:39861450-39861472 CCTGCTTCCAGATACTTTTTCAC No data
Right 1039690662 8:39861463-39861485 ACTTTTTCACTTTGGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039690662 Original CRISPR ACTTTTTCACTTTGGGAGTC AGG Intergenic