ID: 1039690663

View in Genome Browser
Species Human (GRCh38)
Location 8:39861464-39861486
Sequence CTTTTTCACTTTGGGAGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039690657_1039690663 -8 Left 1039690657 8:39861449-39861471 CCCTGCTTCCAGATACTTTTTCA No data
Right 1039690663 8:39861464-39861486 CTTTTTCACTTTGGGAGTCAGGG No data
1039690658_1039690663 -9 Left 1039690658 8:39861450-39861472 CCTGCTTCCAGATACTTTTTCAC No data
Right 1039690663 8:39861464-39861486 CTTTTTCACTTTGGGAGTCAGGG No data
1039690656_1039690663 0 Left 1039690656 8:39861441-39861463 CCGGAAGGCCCTGCTTCCAGATA No data
Right 1039690663 8:39861464-39861486 CTTTTTCACTTTGGGAGTCAGGG No data
1039690655_1039690663 11 Left 1039690655 8:39861430-39861452 CCTAGTTACTGCCGGAAGGCCCT No data
Right 1039690663 8:39861464-39861486 CTTTTTCACTTTGGGAGTCAGGG No data
1039690652_1039690663 20 Left 1039690652 8:39861421-39861443 CCTGCATGACCTAGTTACTGCCG No data
Right 1039690663 8:39861464-39861486 CTTTTTCACTTTGGGAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039690663 Original CRISPR CTTTTTCACTTTGGGAGTCA GGG Intergenic