ID: 1039695211

View in Genome Browser
Species Human (GRCh38)
Location 8:39903225-39903247
Sequence TCATTACCACAGATGGCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039695211_1039695216 21 Left 1039695211 8:39903225-39903247 CCCTGCGCCATCTGTGGTAATGA 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1039695216 8:39903269-39903291 TTTCTGAGAGTGAATTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039695211 Original CRISPR TCATTACCACAGATGGCGCA GGG (reversed) Intronic
918951902 1:191151014-191151036 TTGTTACCAAAAATGGCGCAGGG - Intergenic
920217461 1:204371115-204371137 TCATTGCCACATGTGGCTCATGG + Intronic
923694972 1:236239565-236239587 TCAGTGTCACAGATGGCCCAGGG - Intronic
1063100556 10:2946103-2946125 TGAGAACCAAAGATGGCGCATGG - Intergenic
1065447451 10:25817925-25817947 TCATTTCTACAGATTGGGCAAGG + Intergenic
1065454632 10:25894154-25894176 TCATTACCAGAGATTGTGCTAGG + Intergenic
1065499760 10:26367970-26367992 TCCTTACCACAGAAGGTGAAGGG + Intergenic
1067203166 10:44192472-44192494 TCCTTCCCACAGGTGGCACATGG - Intergenic
1075897132 10:126006442-126006464 TCACTACCACACATGGCACGTGG - Intronic
1078266406 11:9758757-9758779 TCGTGACCACGGATGCCGCAAGG - Intergenic
1078766194 11:14300815-14300837 TCCTTACCACTGAAGGCGGAAGG - Intronic
1087307232 11:96501548-96501570 TTGATACCACAGATGGGGCAAGG - Intronic
1089611579 11:119672358-119672380 TCATTACCCCAGAGGGAGAAGGG + Intronic
1091102351 11:132886768-132886790 TCATTTCCAAAGATGCTGCAGGG - Intronic
1100543630 12:95580957-95580979 TCATGACCAGAGCTGGAGCACGG - Intergenic
1104468792 12:129011688-129011710 TCATTACCACAGGTGGGGTCTGG - Intergenic
1108715686 13:53075718-53075740 TCATCACCATAGAGGGGGCAGGG - Intergenic
1112610291 13:100948701-100948723 TCATTCCCACAGAAGAAGCAGGG - Intergenic
1122859690 14:104577051-104577073 TCACTACCACAGAGGGAGCTGGG + Intronic
1131072282 15:89473374-89473396 CCAGGACCACAGATGGGGCAAGG - Intronic
1133469504 16:6060910-6060932 TCTTTCCCACATATGGCACATGG + Intronic
1135837560 16:25840869-25840891 ACTTGACCACAGATGGCCCATGG - Intronic
1137540817 16:49360413-49360435 TCATCACCACAGCTGGAGCAGGG - Intergenic
1138287535 16:55821576-55821598 TCAGGACCACAGATGGGGCTAGG + Intronic
1139778852 16:69334470-69334492 CCATTACCAGAGAAGGCCCAGGG + Intronic
1140777572 16:78264160-78264182 TCATCACCACAGAGGGCCCCAGG + Intronic
1150674137 17:67230047-67230069 TCATTAAAACAGATGGCAGAAGG - Intronic
1156125042 18:33894051-33894073 CCATTAGTACAGATGGGGCAAGG + Intronic
1156746295 18:40395505-40395527 TCATTACCACAGGTTGAACAGGG + Intergenic
1162765854 19:12919027-12919049 TGATTTCCACACATGGCGCGTGG - Intronic
1168400101 19:56080708-56080730 TCATGACCACAGATGGGACATGG + Intergenic
1168593245 19:57653823-57653845 TTGATACCACAGATGGGGCAAGG - Intergenic
930046781 2:47179560-47179582 TCATTAGCACAGATGGCTGGAGG - Intergenic
930705722 2:54502965-54502987 TCATGACCACAGAGGGAACATGG - Intronic
938170170 2:129069191-129069213 CGATTCCCACAGATGGGGCAGGG + Intergenic
945719145 2:213397014-213397036 TCATTAGCACAGAAGGTGAAGGG - Intronic
1169163699 20:3405252-3405274 TCATTTTCACAGATGGAGAATGG - Intronic
1173310569 20:41892891-41892913 TCAGTACCACAGATGGCTTATGG - Intergenic
1181575223 22:23789899-23789921 ACAGCTCCACAGATGGCGCATGG - Intronic
1184980443 22:48091739-48091761 TCATGCCCACAGTTGGTGCAGGG - Intergenic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
958878074 3:99638300-99638322 TCTTGACCACAGATGGGGAAAGG - Intergenic
961111849 3:124291029-124291051 TCAGTACCCAAGATGGCCCATGG - Intronic
967630668 3:191740390-191740412 ACATTATCACAGCTGGGGCATGG + Intergenic
971689320 4:29812391-29812413 TAATTATCACAGCTGGCGCCAGG - Intergenic
975295297 4:72727186-72727208 TGGTTACCACTGATGGCCCATGG - Intergenic
976526398 4:86096043-86096065 TCATTATCACATATGGCACTAGG + Intronic
1001698941 5:173692646-173692668 TCATTTCCAGAGAGGGCTCAAGG - Intergenic
1011050311 6:83140656-83140678 TCTTTACCACAGATTCCTCATGG + Intronic
1013040251 6:106425953-106425975 TCATGACCACATATGCTGCATGG + Intergenic
1020388850 7:7636596-7636618 TCCTTAACACAGCTGGCCCAAGG + Exonic
1030079795 7:105767410-105767432 TCATTCCCAGAGAGGACGCATGG - Intronic
1034233246 7:149548873-149548895 TCATAAACACAGAAGGGGCAGGG - Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1046943076 8:119950108-119950130 TCCTTTCGACAGATGGTGCAGGG - Intronic
1049981467 9:907970-907992 TCAGTACCACTGATGGCAGATGG + Intronic
1050506750 9:6356660-6356682 TTATTACCAAAGATTGCCCAGGG + Intergenic
1055862690 9:80772042-80772064 TCATTAACACACATGGACCAAGG - Intergenic
1057412550 9:94829858-94829880 TCATGACTACAGGTGGCCCAAGG + Intronic
1194250187 X:91564727-91564749 TCATAAGCACAGATGGCACTTGG - Intergenic
1198603330 X:138308873-138308895 TCTTTACCATATATGGAGCAAGG + Intergenic
1199215021 X:145253144-145253166 TTGATACCACAGATGGGGCAAGG + Intronic
1199538920 X:148936192-148936214 TCATTATCACAGAAAACGCAAGG - Intronic
1200569149 Y:4805976-4805998 TCATAAGCACAGATGGCACTTGG - Intergenic
1200750967 Y:6943829-6943851 TCATTGCCACAGCTGGCTAAGGG + Intronic