ID: 1039695216

View in Genome Browser
Species Human (GRCh38)
Location 8:39903269-39903291
Sequence TTTCTGAGAGTGAATTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039695213_1039695216 14 Left 1039695213 8:39903232-39903254 CCATCTGTGGTAATGAGTCTTTT 0: 1
1: 0
2: 0
3: 16
4: 237
Right 1039695216 8:39903269-39903291 TTTCTGAGAGTGAATTTTTGAGG No data
1039695212_1039695216 20 Left 1039695212 8:39903226-39903248 CCTGCGCCATCTGTGGTAATGAG 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1039695216 8:39903269-39903291 TTTCTGAGAGTGAATTTTTGAGG No data
1039695211_1039695216 21 Left 1039695211 8:39903225-39903247 CCCTGCGCCATCTGTGGTAATGA 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1039695216 8:39903269-39903291 TTTCTGAGAGTGAATTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039695216 Original CRISPR TTTCTGAGAGTGAATTTTTG AGG Intronic
No off target data available for this crispr