ID: 1039701075

View in Genome Browser
Species Human (GRCh38)
Location 8:39962510-39962532
Sequence GCAGAAAATCCTGCATCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039701075_1039701076 0 Left 1039701075 8:39962510-39962532 CCTTTTGATGCAGGATTTTCTGC 0: 1
1: 1
2: 2
3: 31
4: 173
Right 1039701076 8:39962533-39962555 TCCTCAGCTCAGCGAAATCCAGG No data
1039701075_1039701080 29 Left 1039701075 8:39962510-39962532 CCTTTTGATGCAGGATTTTCTGC 0: 1
1: 1
2: 2
3: 31
4: 173
Right 1039701080 8:39962562-39962584 TCTCATGACCAGGAAGAATTAGG No data
1039701075_1039701079 19 Left 1039701075 8:39962510-39962532 CCTTTTGATGCAGGATTTTCTGC 0: 1
1: 1
2: 2
3: 31
4: 173
Right 1039701079 8:39962552-39962574 CAGGATCTTGTCTCATGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039701075 Original CRISPR GCAGAAAATCCTGCATCAAA AGG (reversed) Intronic
900136564 1:1120129-1120151 CGAGAAAATCCTGCCTCAAAAGG + Intergenic
901129551 1:6953795-6953817 GCACATAATCCTACATAAAATGG + Intronic
902920908 1:19665500-19665522 GCAGGAACTCCTGGAGCAAACGG - Exonic
904066407 1:27755279-27755301 GAAGAAGATGTTGCATCAAAAGG + Exonic
909926056 1:81439436-81439458 TGAGAAAATCCTGCATCAGTAGG - Intronic
910663870 1:89703159-89703181 GCAGAAAATCCTGAGACTAAAGG + Intronic
911529301 1:99025128-99025150 GCTGGAAATCCTGCTTCACAAGG + Intergenic
913183050 1:116341353-116341375 GCATAAAATCCTGTACAAAATGG + Intergenic
913530017 1:119727120-119727142 GCAGAAAGTCCCACATCACAGGG - Intronic
914770764 1:150682809-150682831 GAAAAAAATACTGAATCAAAGGG - Intronic
916517675 1:165534962-165534984 GAAGAAAATCCTCCTTCAATAGG + Intergenic
917267332 1:173235183-173235205 GCAAAAAATCCTGCATCAAAAGG - Intergenic
920824448 1:209412325-209412347 GCAGTGCATCCTGCAACAAAAGG + Intergenic
920945063 1:210521189-210521211 GAACAAAATCATGCTTCAAAAGG - Intronic
921003315 1:211067269-211067291 GCAGAGAATCCTTCTTAAAAGGG - Intronic
921679976 1:218020155-218020177 GCAGAAAATCCTGCAGCCAGTGG + Intergenic
921931627 1:220759391-220759413 GCAGAAAATTCTGCAAGAATTGG + Intronic
923403442 1:233637611-233637633 TCATAAAATCTTCCATCAAAAGG - Intronic
924787426 1:247211029-247211051 GCAGGAAGCCCTGCATGAAAAGG - Intergenic
1064787533 10:18915276-18915298 GCAGAAAATGTTGCTTCCAATGG - Intergenic
1064826169 10:19403964-19403986 GCAGAAAATAATACTTCAAATGG + Intronic
1068677226 10:59780452-59780474 GTAGAAACTCCTTCATCAGAAGG - Intergenic
1069174429 10:65272329-65272351 GCAGAAAATCCAGAAGTAAAAGG + Intergenic
1069329988 10:67280381-67280403 GAAAAAAATCCTGCATCACCAGG - Intronic
1070332815 10:75430481-75430503 CCAGGAAATGCTGCAACAAAAGG - Intergenic
1073931787 10:108584912-108584934 GAGAAAAATCCTGCATCAAATGG + Intergenic
1079321552 11:19455853-19455875 CCAGAACCTACTGCATCAAAAGG + Intronic
1081100306 11:38993521-38993543 GCAGAAAATCAAGCATTAAAAGG + Intergenic
1081731242 11:45373212-45373234 TCAGAAATACCTGCATCAAAAGG + Intergenic
1081921067 11:46777519-46777541 GCTGAATATCCTGCAACAACTGG - Exonic
1089110059 11:116048451-116048473 GCAGAAAGTCCTGTATGCAATGG - Intergenic
1089783665 11:120892634-120892656 GCAGAAAGTCCTGCACCCAGGGG - Intronic
1091697470 12:2637703-2637725 TCAGAAAATCCTGCATCCCTGGG + Intronic
1093853949 12:24075872-24075894 GCACAAATTCCTGCATACAAAGG + Intergenic
1095144827 12:38713634-38713656 GTAGAAAATCGTGCTCCAAATGG + Intronic
1096325763 12:50659846-50659868 GCAGGAAATTCTGCCTCAAATGG - Intronic
1097469744 12:59974241-59974263 GCATTAACTCCTGCTTCAAAGGG - Intergenic
1097646954 12:62247966-62247988 GCAAAAAATTCTGCATCAAAAGG - Intronic
1099957780 12:89367962-89367984 ACAGAATATCCTGAATCAAAGGG + Intergenic
1100182414 12:92099964-92099986 GGAGACAATCCTTAATCAAATGG + Intronic
1100387528 12:94117804-94117826 ACAGAGAATCCTGCCTCAGAAGG + Intergenic
1101181481 12:102223287-102223309 CCATAAAATCCAACATCAAAGGG - Intergenic
1101233217 12:102763054-102763076 GCAGCAGCTTCTGCATCAAAGGG + Intergenic
1102741368 12:115210392-115210414 GCAGAACATCCTTCTTCACATGG - Intergenic
1102782109 12:115574261-115574283 GTACAAAATCTTGCTTCAAAAGG - Intergenic
1103156534 12:118689886-118689908 GCAGCAAATCCTCCCTTAAAGGG - Intergenic
1109746564 13:66630932-66630954 TCAGAATATCTTGCAACAAATGG + Intronic
1109860684 13:68194012-68194034 GAATAAGATCCTGCATCCAAAGG - Intergenic
1110184421 13:72656564-72656586 GCAGACTACCCTGCATCATATGG - Intergenic
1110524630 13:76521919-76521941 GTAAAAAATCCTGCATCAATAGG - Intergenic
1110999107 13:82155183-82155205 GCAGAAAATTCTCCATCTAAAGG + Intergenic
1112736694 13:102428861-102428883 TCAGAAAATACTGTATAAAAAGG - Intergenic
1113393810 13:109924158-109924180 GCAGAAAATCATTAATAAAAGGG - Intergenic
1116107955 14:40535876-40535898 GCATAAATGCCTACATCAAAAGG - Intergenic
1117479189 14:56126141-56126163 GCAGAAAGTCCTGCCTTGAAGGG + Intronic
1117706104 14:58469600-58469622 GCAAAGAATCCTGAATTAAAAGG + Intronic
1118256459 14:64209929-64209951 GCTGAAAGGCCTGCATCACATGG - Exonic
1118952500 14:70447110-70447132 GCAAAAAATCCTGCATCATTTGG - Intergenic
1119175840 14:72567230-72567252 GCAGAAAATCCTGCACAAGGGGG - Intergenic
1120748326 14:88173903-88173925 GGTGAGATTCCTGCATCAAATGG - Intergenic
1124267363 15:28249011-28249033 GCAGAAGATCTTGCTTCCAAAGG + Intronic
1125705983 15:41736615-41736637 GGAGAAAGCCCTGCATAAAAAGG - Exonic
1127896836 15:63308182-63308204 GCAGAAAATCCTGAATGGAAGGG - Exonic
1128491828 15:68154705-68154727 GCAGCTAATCCTGAATCAATGGG + Intronic
1130092953 15:80836609-80836631 GCAGAAAATCCAGGAGGAAAAGG - Intronic
1130427222 15:83813537-83813559 GCAGGAGATCATGCCTCAAATGG + Intronic
1135080478 16:19430310-19430332 GCAGAAAACACTGCCTCAAATGG - Intronic
1138234911 16:55373997-55374019 GCTGAAAATCCTCCATCAGCAGG - Intergenic
1138883279 16:61042903-61042925 GCAGAAAAGCCTCTATCAAGCGG + Intergenic
1139723189 16:68873826-68873848 GCTGAAAAGCCAGGATCAAAGGG - Intronic
1140535871 16:75709197-75709219 GCAGAACATGATGCATCAAAAGG - Intronic
1141265353 16:82491566-82491588 TCATAAAATACTTCATCAAAAGG - Intergenic
1143201765 17:5118187-5118209 GAAAAAAATCCTGTATCAATAGG - Exonic
1144014103 17:11177401-11177423 GAACAAAATCCTGCCTCAAAGGG - Intergenic
1144401812 17:14911652-14911674 TCAGAAAATCTTGACTCAAATGG - Intergenic
1149074779 17:52582121-52582143 TCATAAAAACCTGGATCAAATGG - Intergenic
1149180170 17:53926740-53926762 GGAGTAAATCCTGAAGCAAATGG + Intergenic
1149308401 17:55371278-55371300 GGAGAAAGACCTGAATCAAAGGG + Intergenic
1150112156 17:62511215-62511237 GCAGAAACTACTTCATCATAAGG + Intronic
1150541194 17:66101360-66101382 TCAGAAAATACTGTATCACAAGG + Intronic
1154297682 18:13164652-13164674 GCAGCAAGTCCTTCCTCAAAGGG + Intergenic
1155729575 18:29136872-29136894 TCAGAATATCCTGTATAAAATGG - Intergenic
1155736970 18:29235981-29236003 GCAAAAAACCCTGCATCAATAGG + Intergenic
1155948572 18:31883630-31883652 GAAGAAGATGCTACATCAAAAGG + Intronic
1159123452 18:64196316-64196338 TCAGATAATCCTGCATAAAAGGG - Intergenic
1159608821 18:70503888-70503910 TCAGGAAATCCTGCAACATAAGG - Intergenic
1159777544 18:72620657-72620679 GCAGAAAATCCTGAAACCCATGG - Intronic
1160476499 18:79194448-79194470 GCTGAAAAACCTGGTTCAAACGG + Intronic
1160593104 18:79955139-79955161 GCAGAAACTCCTGGATAAACTGG + Intergenic
1161288468 19:3480424-3480446 GCAGAAACTCCAGCACCAGAAGG + Exonic
1163353561 19:16795092-16795114 AAGAAAAATCCTGCATCAAAAGG - Intronic
1168302568 19:55414618-55414640 GCAGAAAATCCAGCAGCAAGTGG + Intergenic
925627019 2:5851661-5851683 TCAGAAAATCCTGAGACAAATGG - Intergenic
925691424 2:6527855-6527877 GGATAAAAACCTGCATGAAATGG + Intergenic
927261076 2:21090962-21090984 TCATAAAATTCTTCATCAAATGG + Intergenic
930721972 2:54646640-54646662 TAAGAAAATGCTGCACCAAAGGG - Intronic
931843292 2:66177041-66177063 GCAGCAAAACCTGCATAAAATGG - Intergenic
933515160 2:83291156-83291178 ACATAAAACCCTACATCAAAAGG - Intergenic
936247074 2:110837580-110837602 GCAGACCTTCCTGCATTAAAGGG - Intronic
936745785 2:115574824-115574846 GCAGAGAATCATGGATCAAGGGG - Intronic
938568894 2:132544468-132544490 GAGAAAAATCCTGCATCAAGGGG - Intronic
939303517 2:140379256-140379278 GCAGAAAATCAGGCATCATATGG - Intronic
939329992 2:140745654-140745676 GAAGAAAATCTTTCATGAAAGGG - Intronic
940168719 2:150803661-150803683 GAGAAAAATCCTGCATCAATAGG - Intergenic
942028892 2:171938612-171938634 GCAGAAAACCCTGCCTCACAAGG + Intronic
942436512 2:175983369-175983391 ACACAAAATCCTGAATCATAAGG + Intronic
944292158 2:198019272-198019294 GAGGAAAATCCAGCATAAAAAGG + Intronic
944682433 2:202089271-202089293 GCAGTAAATCCTGACTCAACAGG - Intronic
945974573 2:216260167-216260189 GCAGATATAACTGCATCAAAGGG - Intronic
946007013 2:216533836-216533858 GCAGGAAACCCTGAATCAAGGGG + Intronic
946020910 2:216639365-216639387 TCTGAAAATTCTGCACCAAAGGG + Intronic
948241630 2:236442375-236442397 GAAGAAAATCTGGCCTCAAATGG + Intronic
948513409 2:238488086-238488108 GGAAAAATTCCTGCATCCAAAGG - Intergenic
948701408 2:239762857-239762879 GCAGAAAAGCCTGCATCATGTGG + Exonic
1169556620 20:6757808-6757830 GCAGAATAAACTGCACCAAATGG + Intergenic
1169637524 20:7708953-7708975 GCAGAAATTCCTTCAGAAAATGG - Intergenic
1175063988 20:56269760-56269782 GCAAAATATCCTGCATCATAGGG + Intergenic
1180705738 22:17808725-17808747 CCAGAAAATCCTGCTGGAAAAGG + Intronic
1182451977 22:30427109-30427131 GCAGAAAATCCTGCGACAAGGGG - Intronic
949629204 3:5904258-5904280 GAGGAAAATCCTGCCTCTAAAGG + Intergenic
949639627 3:6021148-6021170 GGAAAAAATTTTGCATCAAATGG - Intergenic
953544491 3:43854313-43854335 GCAGGAAGTCCTTCAACAAAGGG - Intergenic
955463385 3:59210118-59210140 TCAGAAACACCTGCATCCAAGGG - Intergenic
956225456 3:66952502-66952524 CCTGAAAATACTGAATCAAATGG - Intergenic
958086804 3:88820018-88820040 GCTGAAAATACTGCATCATTTGG + Intergenic
958439068 3:94133760-94133782 GCTGAAAATAATGCATCAATGGG - Intergenic
958449898 3:94259969-94259991 GAAGACAATCCTGCCTCACAGGG + Intergenic
961478011 3:127160652-127160674 GCAGAAAGTCCATCCTCAAAGGG - Intergenic
962626561 3:137231238-137231260 CCAGACGATCCTCCATCAAATGG - Intergenic
963458352 3:145575503-145575525 TCAGAAAAACCTGCATTTAAGGG + Intergenic
964559946 3:157983282-157983304 GCAGAAAACAGTGCATCAGATGG - Intergenic
965718910 3:171638930-171638952 GCAGAAAAGCAAGAATCAAAAGG - Intronic
969123273 4:4925420-4925442 GATGAAAAACCTGCATAAAAAGG - Intergenic
970993423 4:22238415-22238437 AGAGAAAATCGTGTATCAAAAGG + Intergenic
975830323 4:78362338-78362360 GAGAAAAATCCTGCATCAACAGG - Intronic
978169841 4:105656725-105656747 GCTGAACATCCTCCACCAAAAGG - Intronic
979796935 4:124857776-124857798 GCAGCAAGTCCTTCACCAAAGGG - Intergenic
979992405 4:127390715-127390737 GCAGAAAAACTTGCTTTAAATGG + Intergenic
980277776 4:130677283-130677305 GCAGAAAATACTGCAGATAAAGG + Intergenic
982433534 4:155353192-155353214 GAAGAAAATGCTGCAAGAAAAGG - Exonic
983325622 4:166252230-166252252 GAAAAAAATCCTGCATATAAAGG + Intergenic
983508181 4:168578041-168578063 TCAGTATATCCTGCATCCAAAGG - Intronic
987103610 5:14615369-14615391 GCAGAAAAGCCGGCACCCAAAGG - Intergenic
987994826 5:25263425-25263447 GGAGAAACTCCTACAACAAAAGG - Intergenic
988904891 5:35776580-35776602 ACAGTAAATCATGCATCAAAGGG + Intronic
992192864 5:74311198-74311220 CCACAAAAGCCTGCATGAAAGGG + Intergenic
993169455 5:84398815-84398837 TCAGAAAATCATGAATTAAAAGG + Intergenic
996212336 5:120826749-120826771 GCTGAGAATCCTGAATCATAGGG + Intergenic
996734703 5:126748015-126748037 GCATAAAATCCTCCTTCTAAAGG - Intergenic
997630750 5:135367177-135367199 GCAGAAAAGCCTGCATCTCTAGG - Intronic
998808786 5:145944645-145944667 GCAAAAAGTCCTGCAGCAAAGGG - Intronic
999102655 5:149039198-149039220 ACAGAAAAACATTCATCAAAAGG - Intronic
999193772 5:149768098-149768120 GCAGAAAACCCTGCTTCACAGGG + Intronic
999761846 5:154707832-154707854 GCAGAAAACCCTGCTTCACAAGG + Intergenic
1003064964 6:2896376-2896398 TGATAAAATCTTGCATCAAAAGG + Intronic
1003331289 6:5130584-5130606 ACAGAAAAACCTGAAACAAATGG + Intronic
1008949730 6:57143673-57143695 GCAGAAATTGCTGGATCATATGG - Intronic
1014534837 6:122602603-122602625 ACAAAAAATCCTGTATCAATAGG + Intronic
1020864451 7:13540007-13540029 CCAGAAACTCCTGCATCAGTTGG + Intergenic
1023152887 7:37218859-37218881 TCAGAAAATACTGACTCAAAAGG - Intronic
1023676966 7:42640835-42640857 GCAGATTATCCTCCATCATATGG - Intergenic
1023878331 7:44304995-44305017 GCAGAAAAGCATGTATCACAAGG + Intronic
1026494514 7:70890817-70890839 GAAGAAAATCCTGCATCATAAGG + Intergenic
1027793430 7:82660923-82660945 GCAGAAAATCCTGAATGGAAGGG - Intergenic
1028678709 7:93499561-93499583 GCAGAAAAAGCTGCAGTAAAAGG + Intronic
1028781263 7:94739250-94739272 GTAGAATATGATGCATCAAAAGG + Intergenic
1029340421 7:99939325-99939347 TCTGAAGATCCTGGATCAAAGGG - Intergenic
1030838433 7:114317711-114317733 GCAGTAGATCCTGAAGCAAAGGG - Intronic
1031499308 7:122492645-122492667 GCAAAATATCCTGCAACACAGGG + Intronic
1032727329 7:134602969-134602991 GCAGAAAATCCTGCTGCAATTGG + Intergenic
1033272313 7:139943711-139943733 GCAGGAAATTTTGCATAAAAAGG + Intronic
1033455611 7:141500656-141500678 GCAGAAAATCATGCAAAATAAGG - Intergenic
1035427191 7:158786909-158786931 GCAGAAATTGCTGAAACAAAAGG + Intronic
1039701075 8:39962510-39962532 GCAGAAAATCCTGCATCAAAAGG - Intronic
1041600774 8:59714892-59714914 GAAGAAAATCCATCACCAAACGG + Intergenic
1043050993 8:75385344-75385366 GCAGAAAACCCTGCTTCACAAGG - Intergenic
1043696601 8:83227192-83227214 AAAGAAAAAACTGCATCAAAAGG - Intergenic
1043951355 8:86312157-86312179 ACAAAAAATCTTGCATCAAGAGG + Intronic
1044545230 8:93451820-93451842 TCTGAAAAGCCTGCTTCAAAAGG - Intergenic
1044740716 8:95323469-95323491 GCAAAAACTCCTGCACCAACAGG - Intergenic
1044871329 8:96622772-96622794 GATGAATATCCTGCCTCAAAAGG - Intergenic
1047112316 8:121803993-121804015 GAAGAAAATTCTGCATCAGCAGG + Intergenic
1047940212 8:129822122-129822144 GAAGACAAGCCTGCATGAAAAGG + Intergenic
1050211557 9:3264131-3264153 GCAACAAATCGTGCATCCAACGG - Intronic
1051477816 9:17527850-17527872 ACAGAAAATCCTGCATTGATGGG + Intergenic
1051609771 9:18949776-18949798 GCACAAAATCATGAAGCAAAAGG + Intronic
1055420019 9:76129702-76129724 GAAAAAAATCCTTCACCAAAGGG - Intronic
1055708379 9:79033191-79033213 GAGAAAAATCCTGCATCAACTGG - Intergenic
1056570271 9:87808597-87808619 GCACAAAATTCTGCATCTGAAGG + Intergenic
1057056622 9:91966486-91966508 GGAGAAAATACAGCAGCAAAGGG - Intergenic
1057475465 9:95397406-95397428 AAAGGAAATCATGCATCAAAGGG + Intergenic
1058505572 9:105662673-105662695 GGAGCAAAGCCTGCAACAAACGG + Exonic
1059685210 9:116628681-116628703 ACAGAAAATACAACATCAAAAGG + Intronic
1060770664 9:126329569-126329591 GGAGAAGATCCTCCATGAAATGG - Intronic
1185659829 X:1718834-1718856 ACAGAAAATCCCACATTAAAAGG - Intergenic
1185703940 X:2252562-2252584 GCAGAAAATGCATCATCCAAAGG + Intronic
1186276117 X:7939862-7939884 GAAGAAAATTCTGGTTCAAATGG + Intergenic
1187438855 X:19298747-19298769 ACAGAAGATCCTGCATTACAAGG - Intergenic
1188099732 X:26069670-26069692 GATGAAATTCCTGGATCAAATGG + Intergenic
1189009492 X:37032263-37032285 ACAGAAAATTCTGCTTCAAAAGG - Intergenic
1190689389 X:52900894-52900916 GCAGAAATTCCTGCATGGAGAGG - Intronic
1190696594 X:52954898-52954920 GCAGAAATTCCTGCATGGAGAGG + Intronic
1192446932 X:71217931-71217953 GCAGAAAATCCTGGGACAGAAGG + Intronic
1194376826 X:93146199-93146221 GCAGAAAATCTCGTATCAGATGG + Intergenic
1194515218 X:94844291-94844313 GAAGAAAAACCAGCATAAAAAGG - Intergenic
1195384182 X:104297914-104297936 GCAGAAAATGATGCAACCAATGG - Intergenic
1195821420 X:108949432-108949454 TCATAAAATTATGCATCAAAAGG - Intergenic
1200785526 Y:7257287-7257309 GCAGAACATCTTGAAGCAAAGGG + Intergenic