ID: 1039701077

View in Genome Browser
Species Human (GRCh38)
Location 8:39962534-39962556
Sequence TCCTGGATTTCGCTGAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 221}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039701077_1039701080 5 Left 1039701077 8:39962534-39962556 CCTCAGCTCAGCGAAATCCAGGA 0: 1
1: 0
2: 2
3: 17
4: 221
Right 1039701080 8:39962562-39962584 TCTCATGACCAGGAAGAATTAGG No data
1039701077_1039701082 12 Left 1039701077 8:39962534-39962556 CCTCAGCTCAGCGAAATCCAGGA 0: 1
1: 0
2: 2
3: 17
4: 221
Right 1039701082 8:39962569-39962591 ACCAGGAAGAATTAGGCAGGTGG No data
1039701077_1039701086 30 Left 1039701077 8:39962534-39962556 CCTCAGCTCAGCGAAATCCAGGA 0: 1
1: 0
2: 2
3: 17
4: 221
Right 1039701086 8:39962587-39962609 GGTGGACATAGTGAAGGGTGAGG No data
1039701077_1039701084 24 Left 1039701077 8:39962534-39962556 CCTCAGCTCAGCGAAATCCAGGA 0: 1
1: 0
2: 2
3: 17
4: 221
Right 1039701084 8:39962581-39962603 TAGGCAGGTGGACATAGTGAAGG No data
1039701077_1039701081 9 Left 1039701077 8:39962534-39962556 CCTCAGCTCAGCGAAATCCAGGA 0: 1
1: 0
2: 2
3: 17
4: 221
Right 1039701081 8:39962566-39962588 ATGACCAGGAAGAATTAGGCAGG No data
1039701077_1039701085 25 Left 1039701077 8:39962534-39962556 CCTCAGCTCAGCGAAATCCAGGA 0: 1
1: 0
2: 2
3: 17
4: 221
Right 1039701085 8:39962582-39962604 AGGCAGGTGGACATAGTGAAGGG No data
1039701077_1039701079 -5 Left 1039701077 8:39962534-39962556 CCTCAGCTCAGCGAAATCCAGGA 0: 1
1: 0
2: 2
3: 17
4: 221
Right 1039701079 8:39962552-39962574 CAGGATCTTGTCTCATGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039701077 Original CRISPR TCCTGGATTTCGCTGAGCTG AGG (reversed) Intronic
900126154 1:1069754-1069776 CCCTGGACCTCCCTGAGCTGGGG - Intergenic
900898819 1:5503265-5503287 TCCTGAGTTGCTCTGAGCTGGGG + Intergenic
900945359 1:5828235-5828257 GCCTGGACTTCGCGGAGCTCTGG - Intergenic
902837779 1:19058077-19058099 TCCTGCCTTTCTCTGAGCAGGGG - Intergenic
904489642 1:30850430-30850452 TCCCGGATGTAGCTGGGCTGAGG + Intergenic
904581115 1:31544958-31544980 TTCTGGCCTTGGCTGAGCTGAGG - Intergenic
905051573 1:35055794-35055816 TCTTTTATTTCGCTGAGCAGTGG + Intergenic
905390072 1:37630608-37630630 ACCTGGCTCTCGCTGGGCTGGGG - Intronic
906598148 1:47098281-47098303 TCCCAGATTTCTCTGAGCAGTGG + Intronic
907065339 1:51476365-51476387 TCTTTTATTTCGCTGAGCAGTGG + Intronic
908612944 1:65883319-65883341 TCTTTTATTTCGCTGAGCAGTGG + Intronic
909697003 1:78479076-78479098 TCTTTTATTTCACTGAGCTGTGG + Intronic
914240733 1:145850980-145851002 TCCAAGATTTAGCTTAGCTGGGG + Intronic
915104623 1:153525976-153525998 ACCTGGATTTAGCTGAGTTAAGG - Intergenic
916078588 1:161218000-161218022 TCCAGGATATAGCAGAGCTGAGG - Exonic
916308113 1:163362716-163362738 TCCTGGTTTGCCCTGAACTGAGG - Intergenic
917308408 1:173651758-173651780 TCCTTTATTTCGTTGAGCAGTGG + Intronic
919172329 1:193970842-193970864 TCCTGAATATCCCTGAGCTTTGG - Intergenic
919391207 1:196988032-196988054 TCTTTTATTTCGCTGAGCAGTGG + Intronic
920682294 1:208082452-208082474 CCGTGGATTTCGCTGTGGTGTGG - Exonic
922089740 1:222384414-222384436 TCTTTTATTTCGCTGAGCAGTGG + Intergenic
924359704 1:243225246-243225268 TCCTGGTTTTTGGTGAGCAGTGG - Exonic
1063307007 10:4911550-4911572 ACCTGGATTTATCTGAGCTAAGG + Intergenic
1063307435 10:4918165-4918187 ACCTGGATTTAGCTGAACTAAGG - Intergenic
1065192642 10:23227916-23227938 TCTTTGATTTCGATGAGCAGTGG - Intronic
1065425548 10:25599159-25599181 TCCAGCATTTGGTTGAGCTGGGG - Exonic
1065649422 10:27872019-27872041 TCTTTTATTTCGCTGAGCAGTGG + Intronic
1065887883 10:30094834-30094856 TCCCTGATCTCGCTGAGATGTGG + Intronic
1067097670 10:43313158-43313180 TCCTGGATGGCACTCAGCTGTGG - Intergenic
1067319060 10:45199661-45199683 TCCTGGATGTGGCTGAGCTGCGG + Intergenic
1067319741 10:45206115-45206137 TCCTGGATAGGGCTGAGCTGCGG + Intergenic
1067750945 10:48970472-48970494 TCCTGAATGACACTGAGCTGTGG - Intronic
1069709038 10:70477769-70477791 AGCTGGATTTCGGCGAGCTGGGG - Intergenic
1073381210 10:103079311-103079333 TGCTGGCCTTCCCTGAGCTGTGG + Exonic
1074150303 10:110753577-110753599 TCCTGGATTTCACTTCACTGTGG + Intronic
1074631069 10:115255298-115255320 TCTTTTATTTCGTTGAGCTGTGG + Intronic
1075654451 10:124152100-124152122 TCCTGGCTTCCGCTGGGCGGTGG + Intergenic
1075731038 10:124637046-124637068 TCCTGGAGTTTTCTGTGCTGAGG - Intronic
1076590180 10:131577379-131577401 TACAGGATGTCGCGGAGCTGTGG + Intergenic
1077008910 11:371397-371419 TCCTGGACCTCCCTAAGCTGAGG + Intronic
1078119700 11:8494422-8494444 TCCTTTATTTCGTTGAGCAGTGG - Intronic
1081641184 11:44755523-44755545 CCCTGGGGTTTGCTGAGCTGGGG + Intronic
1085414280 11:76309990-76310012 GCCTGGATTTTGCTGAGCCCTGG - Intergenic
1087363806 11:97194394-97194416 TCTTTGATTTCGTTGAGCAGAGG + Intergenic
1091628914 12:2143789-2143811 TCCTGGATTTGGTTGGGTTGTGG + Intronic
1091951005 12:4593053-4593075 TCCTGGGCTACGCGGAGCTGTGG + Exonic
1092298996 12:7227244-7227266 TCTTTTATTTCGCTGAGCAGTGG + Intergenic
1092833014 12:12463497-12463519 TGCTGGACTTCGGAGAGCTGGGG + Intronic
1093178875 12:15945393-15945415 TCTTTGATTTCGTTGAGCAGTGG + Intronic
1093235489 12:16604967-16604989 TCCTTGATTTCGCTTAAGTGTGG + Intronic
1093248561 12:16770694-16770716 TCTCTGATTTCGCTGAGCAGTGG + Intergenic
1094805581 12:34087659-34087681 TCCTTGATTTCATTGAGCAGCGG - Intergenic
1095504396 12:42877787-42877809 TCTTTGATTTCACTGAGCAGTGG - Intergenic
1097419616 12:59358232-59358254 ACCTGGATTTAGCTGAGCTAAGG + Intergenic
1097601652 12:61699879-61699901 ACCCAGATTTAGCTGAGCTGAGG + Intergenic
1097763858 12:63500169-63500191 ACCCAGAATTCGCTGAGCTGTGG - Intergenic
1097775401 12:63638681-63638703 TCTTTGATTTCGTTGAGCAGTGG - Intronic
1098336358 12:69408978-69409000 TACTGGATTTCGCTGAGGCTCGG + Intergenic
1100381755 12:94068735-94068757 TCTTTTATTTCGCTGAGCAGTGG - Intergenic
1103154276 12:118670234-118670256 TCCTTTATTTCGTTGAGCAGTGG + Intergenic
1103227059 12:119296794-119296816 CCCTGGTTATCTCTGAGCTGTGG + Intergenic
1104875339 12:132029862-132029884 TGCTGCAGTTCCCTGAGCTGAGG + Exonic
1106582081 13:31027429-31027451 TCCGGGTTTTCGATGAGCTGGGG - Intergenic
1106817260 13:33422421-33422443 TCTTTTATTTCGCTGAGCAGTGG - Intergenic
1111341959 13:86898350-86898372 TCCTTTATTTCGTTGAGCAGTGG - Intergenic
1115947211 14:38675626-38675648 TCCTTTATTTCGTTGAGCAGTGG - Intergenic
1116730154 14:48611163-48611185 TCTTGTATTTCGTTGAGCAGTGG - Intergenic
1117859732 14:60077071-60077093 TCTTGTATTTCACTGAGCAGTGG + Intergenic
1118793885 14:69122110-69122132 TCCTGTATTTCATTGAGCTGTGG - Intronic
1121985578 14:98502079-98502101 TTCTGGATTCTGCTGGGCTGAGG - Intergenic
1122150149 14:99721280-99721302 ACCTGGATTTCGAGGACCTGGGG + Exonic
1122641483 14:103162307-103162329 ACCTGGATTTAGCTGAACTAAGG - Intergenic
1125134800 15:36328886-36328908 ACCTGGAACTCGCTGAGCTGTGG - Intergenic
1129564225 15:76604689-76604711 TCCTTTATTTCACTGAGCAGTGG + Intronic
1129879764 15:78998903-78998925 TCTCGGATCTGGCTGAGCTGGGG + Intronic
1133528913 16:6634007-6634029 GCCTGGATTTCTTTGAGATGGGG - Intronic
1134312519 16:13088477-13088499 TCCTTTATTTCGCTGAGCAGTGG + Intronic
1135503879 16:23019882-23019904 CGCTGGCTTTCTCTGAGCTGAGG - Intergenic
1135897720 16:26423715-26423737 TCCTTTATTTCGTTGAGCAGTGG - Intergenic
1140261515 16:73384378-73384400 TCCTGGATTTAGCAGGTCTGAGG + Intergenic
1141207710 16:81946232-81946254 TCCTGGTTTTCTGTGAGATGCGG + Exonic
1142406048 16:89890641-89890663 ATCTGCATTTCTCTGAGCTGAGG + Intronic
1142696322 17:1635678-1635700 TCCTGGAAGATGCTGAGCTGTGG - Intronic
1143137356 17:4719332-4719354 TCCCGGTTGTCGCTGAGCAGTGG - Exonic
1144334059 17:14253322-14253344 ACCTGGATCTAGCTGAGCTAAGG + Intergenic
1144685537 17:17223684-17223706 TCCTGGTTCTCGCTCAGCTCTGG - Intronic
1144766066 17:17733183-17733205 TCCTGGCTTTCCCTGATCCGAGG + Intronic
1145009542 17:19360016-19360038 GCCTGGACGTGGCTGAGCTGTGG - Intronic
1146674780 17:34765800-34765822 TCCTGTATTCCACTGTGCTGAGG - Intergenic
1146687392 17:34850476-34850498 TGCAGCATCTCGCTGAGCTGTGG + Intergenic
1147678775 17:42225756-42225778 TCCTGAATATTTCTGAGCTGCGG + Intronic
1149056831 17:52376548-52376570 ACCTGGATTTAGCTGAACTAAGG + Intergenic
1149286675 17:55172815-55172837 TCCTGGCTTGCCCAGAGCTGAGG - Intergenic
1153246105 18:3073961-3073983 ACCTGGATTTAGCTGAACTAAGG + Intronic
1154363103 18:13681757-13681779 TTCCGGAGTTCCCTGAGCTGTGG + Exonic
1156189446 18:34701444-34701466 TCCTAGGTCTCCCTGAGCTGGGG + Intronic
1156398260 18:36718279-36718301 ACATGGATTTCACTGACCTGGGG + Exonic
1157155233 18:45259027-45259049 ACGTGGATTTCCCTGAGCTCTGG + Intronic
1157354971 18:46924740-46924762 TCTTGTATTTCGTTGAGCAGTGG + Intronic
1158310746 18:56155414-56155436 TCTTTTATTTCGCTGAGCAGTGG - Intergenic
1158771475 18:60522487-60522509 TCCTTTATTTCACTGAGCAGTGG + Intergenic
1159309206 18:66686562-66686584 ACCTGGATTTAGCTGAACTAAGG + Intergenic
1159539346 18:69755781-69755803 ACCTGGATTTAGCTGAACTAAGG - Intronic
1159557733 18:69962721-69962743 TCCTGGTTTTCCCAGAACTGAGG - Intergenic
1160625836 18:80204337-80204359 TTCTGGATTTGACTGTGCTGAGG + Intronic
1160629291 18:80234175-80234197 TCCAGGACATCGCTGTGCTGGGG - Intronic
1161446971 19:4323932-4323954 TGGTAGATTTCACTGAGCTGAGG + Intergenic
1162628895 19:11910149-11910171 TCTTTGATTTCGTTGAGCAGTGG - Intronic
1164482528 19:28624144-28624166 TCCTTTATTTCGTTGAGCAGTGG + Intergenic
1164688268 19:30186320-30186342 TCTTTTATTTCGTTGAGCTGTGG + Intergenic
926888923 2:17622651-17622673 GCCTGGTTTTAGCTGAGCTAAGG - Intronic
926904656 2:17794483-17794505 TTCTGGATTGTGCTCAGCTGGGG + Intronic
927860653 2:26558169-26558191 TCCTGGGTCTCCCTGAGCTCAGG + Intronic
931112310 2:59124516-59124538 TCTTTTATTTCGCTGAGCAGTGG + Intergenic
931441583 2:62294021-62294043 TCCTGGATTTCTCAGGGCTGTGG + Intergenic
931491288 2:62750646-62750668 TCTTTTATTTCGCTGAGCAGTGG + Intronic
931787993 2:65638885-65638907 TCCCGGCTTTCTCTGAGCTTAGG + Intergenic
931937933 2:67218909-67218931 TCCTGGAAGTCCCTGAGCAGAGG - Intergenic
933851287 2:86368601-86368623 TTAGGGATTTCACTGAGCTGCGG - Intergenic
934065841 2:88340938-88340960 TCTTTTATTTCGCTGAGCAGTGG - Intergenic
936858069 2:116983845-116983867 TCCTTTATTTCGCTGAGCAGTGG - Intergenic
937884643 2:126891513-126891535 TCCGGGATTCAGCAGAGCTGTGG - Intergenic
938197977 2:129348399-129348421 TACTGGAATTCACTGAGATGTGG - Intergenic
941262551 2:163316042-163316064 ACCTGGATTTAGCTGAACTGTGG - Intergenic
941495990 2:166204988-166205010 TCTTTTATTTCGCTGAGCAGTGG - Intronic
944544747 2:200788083-200788105 CCCTGGATTTCTCTGAGCTGGGG + Intergenic
946177982 2:217933539-217933561 TCCTGGAATTGGCTGTGCTTGGG - Intronic
946752074 2:222902582-222902604 ACCTGGATTTAGCTGAACTAAGG - Intronic
948239690 2:236419627-236419649 CCCTGGATTTTGACGAGCTGTGG - Intronic
948636000 2:239338013-239338035 CCCTGGCTTTCGGTGTGCTGGGG - Intronic
948662356 2:239515293-239515315 TCCTGAGTGTTGCTGAGCTGCGG + Intergenic
1169638972 20:7727021-7727043 TCTTGGAGTTGGCTGAGATGAGG - Intergenic
1169679819 20:8198323-8198345 TCTTTTATTTCGCTGAGCAGTGG + Intronic
1170413737 20:16118136-16118158 TCCTTGATTTCTTTGAGCAGTGG - Intergenic
1170926751 20:20731732-20731754 TCCTGGAATTCTCCGAGGTGGGG - Intergenic
1173000542 20:39102330-39102352 TCCTGGATTGTGCTGTGCTGTGG + Intergenic
1173854285 20:46240109-46240131 GGCTGGATCTCGGTGAGCTGTGG + Intronic
1174114562 20:48218122-48218144 TCCTGGAGTGCTCTGAGCAGGGG - Intergenic
1175744395 20:61445234-61445256 TCCTGGATATTGTTCAGCTGGGG - Intronic
1176915151 21:14616901-14616923 TCCTGGATTTCACTGTGCCCAGG - Intronic
1177008915 21:15707982-15708004 TTCTGGACTTCACCGAGCTGGGG - Intergenic
1178588932 21:33893036-33893058 TCCTGGAATGGGCTGACCTGTGG - Exonic
1179956942 21:44746179-44746201 CCCAGGTTTTCGCTGAGCTAAGG + Intergenic
1182297912 22:29320527-29320549 TTCTTGACTTCACTGAGCTGTGG + Intergenic
1182307493 22:29380789-29380811 TCCTGGCTGTTGCTGAGATGGGG - Intronic
1182790136 22:32945019-32945041 TCCTTTATTTCGTTGAGCAGTGG - Intronic
1183114662 22:35681596-35681618 ACCTGGATTTAGCTGAACTAAGG - Intergenic
1183927717 22:41217777-41217799 TCCTGGATTTCCCGGAGCTTAGG - Intronic
1184530151 22:45050385-45050407 TCCTGGATTTGCAGGAGCTGGGG + Intergenic
1184886372 22:47347451-47347473 TCCTTTATTTCGTTGAGCAGTGG + Intergenic
1185123302 22:48987427-48987449 TCCTTTATTTCGTTGAGCAGTGG + Intergenic
951178999 3:19637118-19637140 TCTTTTATTTCGCTGAGCAGTGG - Intergenic
952587333 3:34908576-34908598 TCTTTTATTTCGTTGAGCTGTGG - Intergenic
954478057 3:50767782-50767804 TCTTTTATTTCGTTGAGCTGTGG + Intronic
954968642 3:54633408-54633430 TCCTGTCTTTAGCTGAGCTAAGG - Intronic
955013363 3:55042809-55042831 TCATGGTTTCCGATGAGCTGTGG - Intronic
955895818 3:63698700-63698722 TCTTTTATTTCGCTGAGCAGTGG - Intergenic
960779314 3:121301210-121301232 TCCTTTATTTCGTTGAGCAGTGG + Intronic
961182182 3:124886389-124886411 TCCTGGAGTTCGCTGCGCCTAGG - Intronic
961865880 3:129953166-129953188 TCCTTGCATTCCCTGAGCTGTGG + Intergenic
963977499 3:151497840-151497862 TCTTTTATTTCGCTGAGCAGTGG + Intergenic
964213935 3:154258430-154258452 TCCTTGCTGTTGCTGAGCTGAGG + Intergenic
965233625 3:166086569-166086591 TTCTGGAAGTCTCTGAGCTGGGG + Intergenic
966355798 3:179077345-179077367 GTCTGGATTTTGCTGAGCTCAGG - Intergenic
973237250 4:47918703-47918725 TCTTTTATTTCGCTGAGCAGTGG + Intronic
973921888 4:55695274-55695296 TCCTTTATTTCGTTGAGCAGTGG - Intergenic
974567297 4:63594078-63594100 TCTTTTATTTCGCTGAGCAGTGG - Intergenic
974568862 4:63617337-63617359 TCCTGGCTTTCGATGAACAGAGG - Intergenic
975809253 4:78149145-78149167 TCCTGGAAATGGCAGAGCTGGGG + Intronic
976272494 4:83245272-83245294 TCCTTTATTTCGTTGAGCTGTGG - Intergenic
978749336 4:112229336-112229358 ACCTGGTTTTAGCTGAACTGCGG + Intergenic
979014676 4:115418682-115418704 ACCTGGATTTAGCTGAACTAAGG + Intergenic
984760458 4:183358603-183358625 TCATGGCTTGCTCTGAGCTGAGG + Intergenic
985188581 4:187345947-187345969 TCAAGGATTTTGCTGAGCAGAGG - Intergenic
989100805 5:37821252-37821274 TCCAGGAATTCACTGAGCTGAGG + Intronic
989584576 5:43064635-43064657 ACCTGGACTTAGCTGAGCTGAGG + Intergenic
990569952 5:57068061-57068083 ACCTGGGTTTAGCTGAGCTAAGG + Intergenic
990777138 5:59315202-59315224 ACCTGGATTTAGCTGAACTGAGG + Intronic
991165535 5:63562671-63562693 ACCTGGAGCTTGCTGAGCTGCGG + Intergenic
991742353 5:69694413-69694435 TCTTGTATTTCGTTGAGCAGTGG + Intergenic
991755341 5:69860795-69860817 TCTTGTATTTCGTTGAGCAGTGG - Intergenic
991793927 5:70274153-70274175 TCTTGTATTTCGTTGAGCAGTGG + Intergenic
991821743 5:70569716-70569738 TCTTGTATTTCGTTGAGCAGTGG + Intergenic
991834668 5:70735943-70735965 TCTTGTATTTCGTTGAGCAGTGG - Intergenic
991886304 5:71273685-71273707 TCTTGTATTTCGTTGAGCAGTGG + Intergenic
994453945 5:99981412-99981434 ACCTGGATTTAGCTGAACTAAGG + Intergenic
997437228 5:133884262-133884284 TCCTGGATCTCCCTGGGCTCCGG + Intergenic
1006436325 6:34027751-34027773 CCCGGGATTTCCCTGTGCTGGGG - Intronic
1006472818 6:34237776-34237798 TCCAGAACTTCCCTGAGCTGCGG - Intronic
1007088396 6:39166782-39166804 TTCTGGGTTTCCCTTAGCTGGGG + Intergenic
1007899251 6:45394763-45394785 ACCCGGGTTTAGCTGAGCTGGGG - Intronic
1008420634 6:51295203-51295225 TCTTGTTTTTCTCTGAGCTGTGG + Intergenic
1010251332 6:73710420-73710442 TCCTTTATTTCGTTGAGCAGTGG - Intronic
1010490212 6:76466653-76466675 TCTCGGATTTAGCTGAGCTAAGG + Intergenic
1012204247 6:96441080-96441102 TCTTTTATTTCGCTGAGCAGTGG - Intergenic
1013677922 6:112487834-112487856 TGCTGTATCTTGCTGAGCTGAGG - Intergenic
1014616196 6:123602618-123602640 TCCTGGAGTCAGCTGAGTTGGGG - Intronic
1015892843 6:137985827-137985849 TCTTTTATTTCGCTGAGCAGTGG + Intergenic
1020956532 7:14745837-14745859 ACCTGGATTTAGCTGAACTAAGG + Intronic
1021101200 7:16586967-16586989 ACCTGGATTTAGCTGAACTAAGG - Intergenic
1021354389 7:19636026-19636048 TCTTTTATTTCACTGAGCTGTGG - Intergenic
1021358615 7:19685033-19685055 TCTTTTATTTCACTGAGCTGTGG + Intergenic
1021492428 7:21233693-21233715 TCTTTTATTTCGCTGAGCAGTGG + Intergenic
1022986642 7:35661537-35661559 TCTTTTATTTCGCTGAGCAGTGG + Intronic
1024245914 7:47470612-47470634 TGCTGCATTTCTCTGCGCTGGGG - Intronic
1028056773 7:86255105-86255127 TCTTTGATTTCGTTGAGCAGTGG - Intergenic
1033534367 7:142298570-142298592 TCCTGGAATTCACTGAGATGAGG + Intergenic
1033887934 7:145971028-145971050 TCTTGTATTTCGTTGAGCAGTGG - Intergenic
1034038469 7:147850244-147850266 TCTTTTATTTCGCTGAGCAGTGG - Intronic
1035772983 8:2164394-2164416 TCCTCGCTTCTGCTGAGCTGTGG + Intronic
1035848888 8:2894177-2894199 TCCTGGCTGTCTCTGAGGTGGGG - Intergenic
1037758921 8:21729141-21729163 GCCTGGTTCTGGCTGAGCTGTGG + Intronic
1039701077 8:39962534-39962556 TCCTGGATTTCGCTGAGCTGAGG - Intronic
1040014091 8:42686874-42686896 TCCTTTATTTCGTTGAGCAGCGG - Intergenic
1040662961 8:49596765-49596787 ACCTGGATTTAGCTGAACTAAGG + Intergenic
1041351629 8:56952818-56952840 ACCTGGATTTAGCTGAACTAAGG + Intergenic
1042442284 8:68842571-68842593 ACCTGGATTTAGCTGAACTAAGG - Intergenic
1045243567 8:100423274-100423296 TTCTGGTTTGAGCTGAGCTGGGG - Intergenic
1045683511 8:104687883-104687905 GCCTGGATCTCGCTGAGATCTGG + Intronic
1046329411 8:112696056-112696078 TCTTTTATTTCGCTGAGCAGTGG - Intronic
1052631641 9:31048788-31048810 TTCAGGGTTTCCCTGAGCTGTGG + Intergenic
1056350547 9:85744459-85744481 ACCTGGATCTAGCTGAGCTAAGG - Intergenic
1056713393 9:89009602-89009624 TGCTGGATTTCTCTGAGCCTTGG - Intergenic
1057895565 9:98906021-98906043 TCCTTGATCTCTCTGAGCTTCGG - Intergenic
1058075673 9:100648229-100648251 TCCTTTATTTCGCTGAGCAGTGG - Intergenic
1185524722 X:768930-768952 TCCTGGATTTGACTGAGGTCAGG - Intergenic
1187531728 X:20103175-20103197 TGCAGGATTTGGGTGAGCTGTGG - Intronic
1189035758 X:37492384-37492406 TCCAGGAAGTCGCAGAGCTGGGG - Intronic
1189660240 X:43288678-43288700 TTCTGCATTTATCTGAGCTGGGG - Intergenic
1191789350 X:64952646-64952668 TCCTTTATTTCGTTGAGCAGTGG - Intronic
1192065999 X:67885611-67885633 TCTTGTATTTCGTTGAGCAGTGG + Intergenic
1192136562 X:68606771-68606793 TCTTTGATTTCACTGAGCAGTGG - Intergenic
1193025931 X:76846035-76846057 TCTTTTATTTCGCTGAGCAGTGG - Intergenic
1194059228 X:89177233-89177255 TCCCGGATTTAGGTGAGCTAAGG - Intergenic
1196853981 X:119965677-119965699 TCTTTGATTTCGTTGAGCAGTGG - Intergenic
1197952651 X:131914441-131914463 TCTTTGATTTCGTTGAGCAGTGG + Intergenic
1197991704 X:132325818-132325840 TCTTTTATTTCGCTGAGCAGTGG - Intergenic
1198781125 X:140236824-140236846 TCTTGTATTTCGTTGAGCAGTGG + Intergenic
1198920022 X:141715054-141715076 TCCTGGATTTCATTGCTCTGTGG - Intergenic
1199058984 X:143330603-143330625 TCCTGTCTTTAGCTGAGCTAAGG + Intergenic
1199151219 X:144489391-144489413 TCCTGGATTTCCTGGAACTGAGG - Intergenic