ID: 1039701079

View in Genome Browser
Species Human (GRCh38)
Location 8:39962552-39962574
Sequence CAGGATCTTGTCTCATGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039701077_1039701079 -5 Left 1039701077 8:39962534-39962556 CCTCAGCTCAGCGAAATCCAGGA 0: 1
1: 0
2: 2
3: 17
4: 221
Right 1039701079 8:39962552-39962574 CAGGATCTTGTCTCATGACCAGG No data
1039701075_1039701079 19 Left 1039701075 8:39962510-39962532 CCTTTTGATGCAGGATTTTCTGC 0: 1
1: 1
2: 2
3: 31
4: 173
Right 1039701079 8:39962552-39962574 CAGGATCTTGTCTCATGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039701079 Original CRISPR CAGGATCTTGTCTCATGACC AGG Intronic
No off target data available for this crispr