ID: 1039708507

View in Genome Browser
Species Human (GRCh38)
Location 8:40031921-40031943
Sequence TGAATTTCAAAGTAACAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039708507_1039708508 -2 Left 1039708507 8:40031921-40031943 CCTTGCTGTTACTTTGAAATTCA No data
Right 1039708508 8:40031942-40031964 CATTCTTTGTTTTTGCATTTTGG No data
1039708507_1039708510 14 Left 1039708507 8:40031921-40031943 CCTTGCTGTTACTTTGAAATTCA No data
Right 1039708510 8:40031958-40031980 ATTTTGGTGTCTCCAAAACAGGG No data
1039708507_1039708509 13 Left 1039708507 8:40031921-40031943 CCTTGCTGTTACTTTGAAATTCA No data
Right 1039708509 8:40031957-40031979 CATTTTGGTGTCTCCAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039708507 Original CRISPR TGAATTTCAAAGTAACAGCA AGG (reversed) Intergenic
No off target data available for this crispr