ID: 1039708828

View in Genome Browser
Species Human (GRCh38)
Location 8:40034988-40035010
Sequence ACTCCTGGTCTTACAATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039708828_1039708831 10 Left 1039708828 8:40034988-40035010 CCTGCAATTGTAAGACCAGGAGT No data
Right 1039708831 8:40035021-40035043 CATGCAAATAGACAGTCCACTGG No data
1039708828_1039708833 27 Left 1039708828 8:40034988-40035010 CCTGCAATTGTAAGACCAGGAGT No data
Right 1039708833 8:40035038-40035060 CACTGGAACATGTCCTAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039708828 Original CRISPR ACTCCTGGTCTTACAATTGC AGG (reversed) Intergenic
No off target data available for this crispr