ID: 1039709109

View in Genome Browser
Species Human (GRCh38)
Location 8:40037664-40037686
Sequence TGGATAGAAGAACCCTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039709109_1039709111 -10 Left 1039709109 8:40037664-40037686 CCTCAGGAGGGTTCTTCTATCCA No data
Right 1039709111 8:40037677-40037699 CTTCTATCCATGGCTTGACATGG No data
1039709109_1039709114 26 Left 1039709109 8:40037664-40037686 CCTCAGGAGGGTTCTTCTATCCA No data
Right 1039709114 8:40037713-40037735 AGCCTTTACATCTGCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039709109 Original CRISPR TGGATAGAAGAACCCTCCTG AGG (reversed) Intergenic
No off target data available for this crispr