ID: 1039720166

View in Genome Browser
Species Human (GRCh38)
Location 8:40155422-40155444
Sequence GTGAATTACCTCACATCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039720165_1039720166 21 Left 1039720165 8:40155378-40155400 CCTAAAGTGTTTTTCAAAATGCT 0: 1
1: 0
2: 8
3: 92
4: 1053
Right 1039720166 8:40155422-40155444 GTGAATTACCTCACATCTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039720166 Original CRISPR GTGAATTACCTCACATCTGC TGG Intergenic
900514418 1:3074538-3074560 GTAAGTGACCTCACACCTGCAGG + Intronic
901248768 1:7756215-7756237 GTGACTTACCTCACAGCACCAGG - Intronic
902159622 1:14519639-14519661 GTGAATATCCTCCCATCTGGAGG + Intergenic
905093461 1:35448540-35448562 GAGAATTCCCACACATGTGCTGG + Intronic
917459821 1:175220596-175220618 GTCAAATAAATCACATCTGCAGG + Intergenic
918049001 1:180958157-180958179 ATCTATTACCTCAAATCTGCAGG - Intergenic
919565979 1:199188868-199188890 ATGAATTATTTCACATCTGCAGG + Intergenic
921874318 1:220176918-220176940 AGGAATTACCTCACTTGTGCAGG + Intronic
921926723 1:220716560-220716582 GTGAATTACCTCTCCTCTTGAGG - Intergenic
923132835 1:231092304-231092326 GTGAATTTCCCCACACATGCTGG - Intergenic
1073558855 10:104480294-104480316 GTGACTTCCCTCACAGCTGATGG + Intergenic
1074266408 10:111908498-111908520 GTGCATTGCCTTACCTCTGCAGG + Intergenic
1076186447 10:128453429-128453451 GTGATTTAATTCACATCTACTGG - Intergenic
1076935450 10:133565648-133565670 GAGAATTACCTCACATCTCCAGG - Intronic
1078563195 11:12390785-12390807 ATTAATTACCTGTCATCTGCAGG - Intronic
1082210829 11:49498962-49498984 GTGAACTATCCCACTTCTGCAGG + Intergenic
1084973380 11:72783309-72783331 GTGAATGACCTTAGATCTCCAGG + Intronic
1086638806 11:89125827-89125849 GTGAACTATCCCACTTCTGCAGG - Intergenic
1087971306 11:104488187-104488209 ATGAATTAACTCCCATTTGCTGG + Intergenic
1088626029 11:111731393-111731415 GTGCATTCCCTCACATGGGCGGG + Intronic
1089715799 11:120357898-120357920 GTGAAATAGCTCACATTTTCAGG + Intronic
1090124482 11:124071510-124071532 GTGAAATACCTAACATCGGCCGG + Intergenic
1098078145 12:66755751-66755773 GTGAATTCCCTGACATTTCCAGG - Intronic
1101073121 12:101097144-101097166 ATGAATTCCCTTACATCTGGAGG + Intronic
1109483491 13:62987805-62987827 GTTAATTAAAGCACATCTGCAGG - Intergenic
1117068690 14:52036007-52036029 GTGAATTACTTCTCAACTGAAGG - Intronic
1123673199 15:22681353-22681375 GTGAATTGGCTGACAGCTGCAGG - Intergenic
1123994357 15:25707967-25707989 GTTAATTACCTAACAAGTGCAGG + Exonic
1124153370 15:27202503-27202525 GTGAATTACCACATCTCTCCTGG - Intronic
1124325254 15:28754646-28754668 GTGAATTGGCTGACAGCTGCAGG - Intergenic
1124876007 15:33594043-33594065 GTGAATTTCCTCTCCTCTGGAGG + Intronic
1125421604 15:39510225-39510247 GAGAATGAGCTCACAACTGCGGG + Intergenic
1127010508 15:54621090-54621112 GTGAATTGCCTCATCTCAGCAGG + Intronic
1134784586 16:16930225-16930247 GTGAGTTACCTTACATCTCTGGG - Intergenic
1137556636 16:49474425-49474447 GTGAATTAATTCACCTCTGAGGG - Intergenic
1138027744 16:53535872-53535894 GTGATTTATGCCACATCTGCTGG + Intergenic
1138196494 16:55056121-55056143 GTGCATAACCCCACATATGCAGG + Intergenic
1138877266 16:60967083-60967105 GTGGATTACCATACATCGGCTGG + Intergenic
1141092722 16:81141288-81141310 GTGGATTACCTGGCATGTGCAGG + Intergenic
1145226627 17:21134404-21134426 GTGAATTTCCTCACCTCTTTAGG + Intronic
1153970978 18:10226890-10226912 GTGCCTTCCCTCACCTCTGCTGG - Intergenic
1157718941 18:49908624-49908646 GTGTATTAACAAACATCTGCAGG - Intronic
1160260768 18:77292185-77292207 GTGAATTCCCACAGATCTGAAGG - Intergenic
1160302933 18:77702847-77702869 GTGAATTGGCTGCCATCTGCTGG + Intergenic
1161975529 19:7606165-7606187 GTCAAGTCCCTCCCATCTGCAGG + Intronic
1164426507 19:28146549-28146571 ATGCATCACCTCACATCTGGAGG + Intergenic
1168466639 19:56607561-56607583 TTCAATTACCTAACCTCTGCAGG - Intronic
925923419 2:8653505-8653527 GTGAATCAGCTCAGTTCTGCAGG + Intergenic
928848041 2:35704429-35704451 GTGAATTTTCTTACAGCTGCTGG + Intergenic
935761920 2:106328849-106328871 GTGACCTGCCTCACCTCTGCAGG - Intergenic
941013404 2:160326996-160327018 CTAAATCACCTCAAATCTGCAGG - Intronic
942999020 2:182301210-182301232 TTGCATTACCCCAAATCTGCTGG + Intronic
943709110 2:191070437-191070459 GTGAGTTACTTCACATCTCGTGG - Intronic
943805198 2:192115785-192115807 GAGTATCACCTCACGTCTGCTGG + Intronic
945460235 2:210099623-210099645 CTGAAGTATCTCACATCTTCCGG + Intronic
1173658166 20:44715313-44715335 GGGAGTGACCTCACAGCTGCCGG + Intronic
1175610563 20:60347813-60347835 AGGAATTACCCCCCATCTGCAGG + Intergenic
949303329 3:2610033-2610055 GTTAATTACCTACCATGTGCGGG - Intronic
950531680 3:13555971-13555993 GTCACATACCTCACATCTCCTGG + Intronic
950824302 3:15800535-15800557 CTGAATTACCTCACTTGTACTGG - Intronic
955706627 3:61734246-61734268 CTGAAATACCTAAAATCTGCAGG + Intronic
964403583 3:156325088-156325110 GTGAAATACCTTACACCTACTGG + Intronic
965267633 3:166565506-166565528 GTTAATTACCTCACATATGTAGG - Intergenic
969998416 4:11339088-11339110 CTGAATTCCCCCACACCTGCAGG + Intergenic
971202620 4:24525435-24525457 GTTAATTTCCTGACATTTGCAGG + Intronic
980471491 4:133258363-133258385 GTGAATTACCTCTCCTCTTGAGG + Intergenic
981259866 4:142706842-142706864 GTGAATTATTTCAGATCTTCTGG + Intronic
982927950 4:161363498-161363520 GAGAATTACATCAGATCTCCAGG + Intergenic
984191273 4:176608583-176608605 TTGAATTTCCTTACATCTCCAGG - Intergenic
985226955 4:187771612-187771634 GTGAATTTCCTCTCCTCTGGAGG + Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
991295119 5:65072373-65072395 CTGAAGTCCCTCACATCTTCTGG + Intergenic
996771556 5:127091934-127091956 GTAAATTAATTCACAACTGCAGG + Intergenic
1002711750 5:181199072-181199094 GTGAGTGACCTCACAGCTCCTGG - Intronic
1006028986 6:31165433-31165455 GTGAAATTCCTCAGTTCTGCTGG - Intronic
1006540111 6:34732959-34732981 GTGAATTACCACAAATTTGGTGG - Intergenic
1011263324 6:85490644-85490666 GTGACTTACCGCCCACCTGCAGG - Exonic
1014132479 6:117850239-117850261 GTGAATTTCCTCTCCTCTTCAGG + Intergenic
1018355524 6:163011059-163011081 GTGAATTAGCTCACCTCCCCTGG + Intronic
1028721747 7:94040802-94040824 GTGAATAACCTCAGAAATGCAGG + Intergenic
1028839294 7:95410078-95410100 GTGAATGACATCACAGCTGTTGG - Exonic
1028918277 7:96283964-96283986 GTAAGTTACCTCACATCTTTTGG - Intronic
1039620622 8:38994192-38994214 GTGTATTACCTGATATCTGTGGG + Intronic
1039720166 8:40155422-40155444 GTGAATTACCTCACATCTGCTGG + Intergenic
1041437580 8:57859520-57859542 TTGAATAACCTAACTTCTGCAGG + Intergenic
1044534870 8:93346790-93346812 CTGAATTATCTCACACCAGCAGG + Intergenic
1045153257 8:99434264-99434286 GACAATTTCCTCACATCTGTAGG - Intronic
1046185329 8:110707156-110707178 GTGGATTACATAAAATCTGCAGG + Intergenic
1047267722 8:123323466-123323488 GTGAACTACCTCACCACTTCAGG + Intronic
1057276797 9:93680486-93680508 GTGAATGACCACAGGTCTGCGGG - Intergenic
1058645077 9:107124243-107124265 GAGAAGTACCTTACATGTGCAGG + Intergenic
1059576550 9:115495161-115495183 GTTAAATACCTCTCATGTGCCGG - Intergenic
1061596710 9:131635229-131635251 CTGAATTTCCTCAAATCTTCAGG + Intronic
1185721712 X:2387838-2387860 GTGAATTTCCTCACAGCAGGCGG + Intronic
1191869016 X:65729704-65729726 GGGAACCACCTCACCTCTGCGGG - Exonic
1193669666 X:84368835-84368857 CTGTTTTACCTCACATCAGCAGG + Intronic
1194060238 X:89187633-89187655 GCAAATTACCTCACATCTCCAGG - Intergenic
1196969553 X:121094291-121094313 ATGAATTACCTCAATTCTGTTGG + Intergenic
1197234509 X:124044453-124044475 CTGAATTACCTTACATCTCTAGG + Intronic